The ECa109 cells expressing Flag-USP3 or HA-Aurora A were first washed on a 6 cm culture plate with PBS buffer. The cells on each plate were then scraped off and were lysed with 1 ml of ice-cold RIPA lysis buffer. Cell lysates were collected and anti-Flag beads (Sigma, USA) or anti-HA beads (Sigma, USA) were added. The resulting immunoprecipitate was shaken overnight at 4 °C. The beads were washed and loaded into the loading buffer, and the levels of bound proteins were detected by SDS-PAGE followed by western blotting.
Anti ha beads
Manufactured by Merck Group
Sourced in United States, Germany
Anti-HA beads are a lab equipment product used for protein purification and detection. They are designed to specifically bind and capture proteins tagged with the hemagglutinin (HA) epitope. The core function of Anti-HA beads is to enable the isolation and enrichment of HA-tagged proteins from complex samples.
Automatically generated - may contain errors
Lab products found in correlation
Anti flag m2 bead, by Merck Group (7 mentions)
Anti flag beads, by Merck Group (6 mentions)
Anti flag, by Merck Group (4 mentions)
Polyvinylidene fluoride membrane, by Bio-Rad (3 mentions)
Protease inhibitor mixture tablet, by Roche (2 mentions)
Iodoacetic acid, by Thermo Fisher Scientific (2 mentions)
Anti egfr, by Santa Cruz Biotechnology (2 mentions)
Anti phospho egfr, by Cell Signaling Technology (2 mentions)
Anti flag m2 peroxidase, by Merck Group (2 mentions)
Anti pan akt, by Cell Signaling Technology (2 mentions)
Anti pser473 akt, by Cell Signaling Technology (2 mentions)
Ha peroxidase, by Merck Group (2 mentions)
Anti ptp1b fg6, by Merck Group (2 mentions)
Pt 66 agarose conjugated beads, by Merck Group (2 mentions)
Anti ptp1b pser50 ab62320, by Abcam (2 mentions)
Streptavidin hrp, by GE Healthcare (2 mentions)
Surfact amps nonidet p 40, by Thermo Fisher Scientific (2 mentions)
Zeba desalt spin column, by Thermo Fisher Scientific (2 mentions)
Ez link biotin iodoacetyl peg2 biotin iap, by Thermo Fisher Scientific (2 mentions)
Biacore sensor nta, by GE Healthcare (2 mentions)
54 protocols using anti ha beads
1
Immunoprecipitation of Flag-USP3 and HA-Aurora A
2
Protein Interaction and Modification Analysis
3
Immunoprecipitation Protein Extraction
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For immunoprecipitation, whole cell extracts were prepared after transfection or stimulation with appropriate ligands, followed by incubation overnight with the appropriate antibodies plus anti-Flag beads (Sigma-Aldrich), anti-HA beads (Sigma-Aldrich), or protein A/G beads (Thermo Fisher Scientific). Beads were washed three to five times with low-salt lysis buffer, and immunoprecipitates were eluted with 3× SDS loading buffer (Cell Signaling Technology) and resolved by SDS-PAGE. Proteins were transferred to polyvinylidene fluoride membranes (Bio-Rad Laboratories) and further incubated with the appropriate antibodies. LumiGlo Chemiluminescent Substrate System (KPL) was used for protein detection.
4
YY1-EGFP and HDAC Coimmunoprecipitation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The YY1-EGFP expression vectors and HDAC1-HA or HDAC3-HA expression vectors were cotransfected into HEK293T cells. Cells were lysed with IP buffer (10 mM Tris pH8.0, 150 mM NaCl, 1% NP-40, 1 mM EDTA pH8.0, 10% glycerol). Total protein was incubated with anti-EGFP mAb-agarose (MBL) or anti-HA beads (Sigma). Captured agarose bead-Ab-Ag complexes were washed with IP buffer and detected by western blotting using anti-EGFP antibody (Invitrogen) and anti-HA antibody (Abways).
5
Hsp90 Mutant Protein Evaluation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Plasmids expressing Flag (F)‐Hsp90, K292Q, and K292R mutant were described previously.6 The following reagents and antibodies were used: Cdc37, cyclin‐dependent kinase 4 (CDK4), Cyclin D1, Hsp27, p‐(S326)‐Heat shock factor 1, and Serine/threonine‐protein kinase 33 (Abcam, Cambridge, MA, USA); p21Cip1 (BD Biosciences, Sparks, MD, USA); AKT, p‐AKT, caspase‐3, cleaved caspase‐3, caspase‐8, active caspase‐8, caspase‐9, cleaved caspase‐9, p‐Cdc37, CDK2, CDK6, Cyclin D1, Eukaryotic elongation factor 2 kinase, p‐eEF2K (S366), Hsp70‐Hsp90 organizing protein 1, HSF1, MEK1/2, p‐MEK1/2, Erk1/2, p‐Erk1/2, and poly(ADP‐ribose) polymerase (PARP)1 (Cell Signaling Technology, Danvers, MA, USA); Hsp40/Hdj1, Hsp70, Hsp90α, and p23 (Enzo Life Sciences, New York, NY, USA); Platelet‐derived growth factor receptor β (Merck Millipore, Temecula, CA, USA); Raf‐1 (C20) and Activator of Hsp90 ATPase protein 1 (Santa Cruz Biotechnology, Dallas, TX, USA); LBH589, Sim, mevastatin (Mev), pravastatin, anti‐Myc beads (Selleck Chemicals, Houston, TX, USA); mevalonate, anti‐Flag, β‐actin, anti‐M2, and anti‐HA beads (Sigma‐Aldrich, St. Louis, MO, USA); and Transforming growth factor‐β receptor II (Thermo Fisher Scientific, Grand Island, NY, USA). Secondary antibodies were from Jackson ImmunoResearch (West Grove, PA, USA).
6
Investigating CUL4A-LATS1 Interactions in Gastric Cancer
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total protein was extracted from GC tissues and cells by lysing in ice-cold lysis buffer. The proteins were electrophoresed on an SDS-PAGE gel, transferred to a PVDF membrane (Millipore, Danvers, MA, USA), and probed with a primary antibody targeted against CUL4A (Abcam, Cambridge, MA, USA), p21 (Abcam), p27 (Abcam), E-cadherin (Abcam), N-cadherin (Abcam), MST1 (Cell Signaling, Danvers, MA, USA), MST2 (Cell Signaling), LATS1 (Cell Signaling), YAP (Cell Signaling), p-YAP (Cell Signaling), vimentin (Cell Signaling), fibronectin (Cell Signaling) or β-actin (Cell Signaling). After incubating with the primary antibody, membranes were washed with TBS/0.05% Tween-20 (TBST) and incubated with a horseradish peroxidase-conjugated secondary antibody (Cell Signaling) for 1 h at room temperature. After washing 3 times with (TBST) for 15 min, the membranes were developed using an ECL plus western blotting detection system.
For IP assays, HGC-27 cells were transfected with the Flag-LATS1 plasmid or co-transfected with Flag-LATS1 and HA-CUL4A plasmids, then treated with MG132 (10 μmoL) for 6 h, and lysed with the lysis buffer. Cell lysates were incubated with 5 μL of anti-HA beads (Catalog Number E6779, Sigma, USA) at 4°C for 4 h, then centrifuged and washed with RIPA buffer for 3 times. IP samples were immunoblotted in subsequent experiments.
For IP assays, HGC-27 cells were transfected with the Flag-LATS1 plasmid or co-transfected with Flag-LATS1 and HA-CUL4A plasmids, then treated with MG132 (10 μmoL) for 6 h, and lysed with the lysis buffer. Cell lysates were incubated with 5 μL of anti-HA beads (Catalog Number E6779, Sigma, USA) at 4°C for 4 h, then centrifuged and washed with RIPA buffer for 3 times. IP samples were immunoblotted in subsequent experiments.
7
Monitoring Protein-RNA Interactions by IP
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To monitor protein-RNA interactions, immunoprecipitations were conducted with HEK293T cells transfected in 10-cm dishes (for Bicc1 WT, 1 μg DNA was used; for Bicc1 mutD, mutant Bicc1 lacking SAM [Bicc1ΔSAM], and the Bicc1 bpk mutant, 2 μg DNA was used). At 36 h after transfection, cells were washed with PBS and resuspended in extraction buffer, consisting of 20 mM Tris-HCl, pH 7.4, 2.5 mM MgCl2, 100 mM NaCl, 5% glycerol, 1 mM DTT, 0.05% NP-40, RNasin (Promega), and protease inhibitors (Roche). After a brief sonication and centrifugation at 10,000 × g for 10 min, the supernatants were incubated for 2 h at 4°C with anti-HA beads (Sigma) on a wheel. After five washes of 5 min each in washing buffer, consisting of 20 mM Tris-HCl, pH 7.4, 2 mM MgCl2, 200 mM NaCl, 1 mM DTT, and 0.1% NP-40, RNAs were isolated by phenol-chloroform extraction, followed by ethanol precipitation and RQ1 DNase (Promega) treatment. Reverse transcription-PCR (RT-PCR) analyses were carried out using SuperScript II reverse transcriptase (Life Technologies) according to the manufacturer's recommendations. The reverse transcription was performed using the following primer: CAGTGCAGGGTCCGAGGTATTCGGCCTCTGCGCTTTCTC. The PCR was carried out using the forward primer GAAGATCGGGTTGAACATGGGTCC and the reverse primer CAGTGCAGGGTCCGAGGTATTC.
8
Affinity-based Protein Purification Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Before lysis, cells were treated with the indicated compounds (see figures) for 20 min or left untreated. Lysis was done in 50 mM Tris, pH 7.4, 150 mM NaCl, 15 mM EDTA, 1% NP-40 supplemented with phosphatase inhibitors (Phosphostop, Roche, Germany), and protease inhibitors (cOmplete, Roche, Germany). Cell lysates were incubated with affinity beads for 2 hours at 4 °C while rotating (Glutathione Sepharose 4B (GE healthcare), GFP nanobody coated beads (Chromotek, Planegg, GE), anti-FLAG M2 beads (Sigma, St. Louis, MO, USA), anti-HA beads (Sigma, St. Louis, MO, USA)). Alternatively, for immunoprecipitation of endogenous PKD2, lysates were incubated with 2 µg anti-PKD2 antibody (Bethyl Laboratories, Montgomery, TX, USA) for 2 h, after which protein A beads were added for another hour. Next, the beads were washed twice with NENT500 (50 mM Tris, pH 7.4, 1 mM EDTA, 500 mM NaCl, 0.1% NP40, 25% glycerol) and once with NENT150 (cf. NENT500 but containing 150 mM NaCl). Alternatively, in co-IP experiments, three washes with NENT150 were performed. Elution was done in 50 mM Tris.HCl pH 7.4, 50 mM NaCl, 25% glycerol using competing peptide (FLAG/HA pulldowns), 20 mM glutathione (GST-pulldowns) or boiling in SDS sample buffer for 5 min at 95 °C.
9
Immunoprecipitation and phosphatase treatment protocol
10
KRAS Signaling Pathway Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
HEK293T cells were transfected with chimeric adaptor-expressing plasmids and mutant KRAS-expressing plasmid and were lysed 48 h later with lysis buffer. The lysate were then subjected to electrophoresis, followed by transferring onto the membrane and detection with the primary antibodies including anti-KRAS (mouse monoclonal, CST) or anti-beta-actin (mouse monoclonal, MBL). For the co-IP experiment, the lysate were incubated with anti-HA beads (Sigma) overnight at 4°C. Then IP products were centrifuged and washed three times with lysis buffer. Western blot was conducted to analyze the immunoprecipitated samples with the primary antibodies including anti-KRAS (rabbit polyclonal, MBL) or anti-HA (mouse monoclonal, MBL).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!