Log In Sign up
The largest database of trusted experimental protocols

Iscript select kit

Manufactured by Bio-Rad
Visit Supplier
Sourced in United States, United Kingdom

The IScript select kit is a product offered by Bio-Rad for reverse transcription. It is used to convert RNA to cDNA, which can then be used for various downstream applications such as PCR and qPCR.

Automatically generated - may contain errors

Lab products found in correlation

Tissuelyser, by Qiagen (1 mentions) Abi prism 7500 pcr system, by Thermo Fisher Scientific (1 mentions) Rneasy mini kit, by Qiagen (1 mentions) Rneasy mini, by Qiagen (1 mentions) Experion, by Bio-Rad (1 mentions) Nanodrop, by Thermo Fisher Scientific (1 mentions) Rneasy lipid tissue mini kit, by Qiagen (1 mentions) Taqman mirna assay, by Thermo Fisher Scientific (1 mentions) C1000 thermal cycler, by Bio-Rad (1 mentions) Sybr green assay, by Agilent Technologies (1 mentions)

Spelling variants of this product

IScript (787 citations) IScript kit (577 citations) IScript Select cDNA Synthesis Kit (402 citations) IScript select (6 citations) BIORAD iScript Select cDNA synthesis Kit (4 citations) IScript Select cDNA kit (2 citations)

7 protocols using iscript select kit

1

Extracting and Quantifying RNA in C. elegans

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted from ∼1000 worms. The worms were washed three times in M9 and one time in DEPC treated water, transferred into Sigma-Aldrich Tri-reagent and frozen in −80°C for at least 16 hours. Thawing was performed on ice with occasional vortexing. We then physically disrupted worms using 3 mm Nirosta beads and QIAGEN TissueLyser at a 50 oscillations/sec for 3 minutes. This was followed by a standard tri-reagent RNA purification protocol. RT-PCR was carried out using random primers, the iScript select kit (BioRad), and a Real-Time PCR machine (Applied Biosystems QuantStudio flex system). Gene expression level were normalized to actin (act-1) expression, and the fold-change relative to the basal expression levels of the gene following 24 hours of recovery from the starvation period was determined.
Eliezer Y., Deshe N., Hoch L., Iwanir S., Pritz C.O, & Zaslaver A. (2019). A Memory Circuit for Coping with Impending Adversity. Current Biology, 29(10), 1573-1583.e4.
+ Open protocol
+ Expand
2

Quantitative RT-PCR Analysis of IGF1R and INSR

Check if the same lab product or an alternative is used in the 5 most similar protocols
RNA isolation (RNeasy Mini kit; QIAGEN), cDNA synthesis (iScript Select kit; Bio-Rad), and qRT-PCR (ABI Prism 7500 PCR-System; Applied Biosystems, Life Technologies) were described elsewhere in detail (14 (link)). Primer and TaqMan probes for IGF1R, INSR, and TATA-binding protein as endogenous control were designed according to the NCBI database. Primer/probe sequences are summarized in Supplemental Table 2.
Ofer P., Heidegger I., Eder I.E., Schöpf B., Neuwirt H., Geley S., Klocker H, & Massoner P. (2015). Both IGF1R and INSR Knockdown Exert Antitumorigenic Effects in Prostate Cancer In Vitro and In Vivo. Molecular Endocrinology, 29(12), 1694-1707.
+ Open protocol
+ Expand
3

KRAS Mutation Detection by RFLP

Check if the same lab product or an alternative is used in the 5 most similar protocols
The RFLP method is schematically presented in S1 Fig. Specifically, total cell RNA was isolated and treated with DNase using RNeasy Mini (Qiagen). 2–10 μg of total RNA was reverse transcribed with KRAS gene-specific primer Kras 001 (CTTGCTTCCTGTAGGAATCCTCT) in a 20 μl reverse transcriptase reaction using IScript SelectKit (Bio-Rad) and a Bio Rad thermal cycler. Fraction of cDNA was amplified by polymerase chain reaction (PCR) using primer set Kras 014 (ACTGAATATAAACTTGTGGTCCATGGAGCbxT) and Kras 001 (CTTGCTTCCTGTAGGAATCCTCT). The PCR amplicon is 127bp. Primer Kras 014 introduces a Bst XI site, which recognizes Kras WT sequence and cuts the PCR amplicon to 99 bp and 28 bp fragments, Bst XI does not recognize mutant G12D sequence. Both digested (Bst XI) and undigested PCR products were electrophoresed on a 4% agarose gel to score WT transcripts and mutant transcripts. In addition, the digested PCR amplicons were analyzed on Experion (Bio-Rad) with improved detection sensitivity. 1μl of digested amplicons was loaded onto a DNA 1K chip and the fragments were visualized and analyzed by the Experion analysis software.
Rao D.D., Luo X., Wang Z., Jay C.M., Brunicardi F.C., Maltese W., Manning L., Senzer N, & Nemunaitis J. (2018). KRAS mutant allele-specific expression knockdown in pancreatic cancer model with systemically delivered bi-shRNA KRAS lipoplex. PLoS ONE, 13(5), e0193644.
+ Open protocol
+ Expand
4

Quantitative RT-PCR of Spliced PDYN Variants

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was purified using RNeasy Lipid Tissue Mini Kit (QIAGEN, Maryland, USA), treated with RNase–free DNase I on-column for 30 min at room temperature and stored at −80°C for further use. Total RNA amount was quantified by Nanodrop® (Nanodrop Technologies, Inc., USA). RNA Quality Indicator was analyzed by Eukaryote Total RNA StdSens assay using a Bio-Rad Experion instrument (Bio-Rad Laboratories, Hercules, CA, USA). For cDNA synthesis, total mRNA was reverse transcribed with PDYN-specific primer (Table 2, Fig. S1) using iScript Select kit (Bio-Rad Laboratories, Hercules, CA, USA). PDYN specific 3´-primer is complementary to the exon 4 sequence that was spliced out as an intron in ΔSP/NLS-PDYN mRNA, thus allowing detection of only ΔSP- but not ΔSP/NLS-PDYN mRNA.
Kononenko O., Bazov I., Watanabe H., Gerashchenko G., Dyachok O., Verbeek D.S., Alkass K., Druid H., Andersson M., Mulder J., Svenningsen Å.F., Rajkowska G., Stockmeier C.A., Krishtal O., Yakovleva T, & Bakalkin G. (2016). OPIOID PRECURSOR PROTEIN ISOFORM IS TARGETED TO THE CELL NUCLEI IN THE HUMAN BRAIN. Biochimica et biophysica acta, 1861(2), 246-255.
+ Open protocol
+ Expand
5

Quantitative Real-Time PCR and miRNA Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols
cDNA was generated using iScript‐select kit (Bio‐Rad) and was utilized as a template for quantitative real‐time PCR performed with the C1000 Thermal Cycler Bio‐Rad. The PCR mixture contained Taq polymerase (SYBR green Bio‐Rad). miRNAs were quantified using TaqMan miRNA Assays (Thermo Fisher).
Hanan M., Simchovitz A., Yayon N., Vaknine S., Cohen‐Fultheim R., Karmon M., Madrer N., Rohrlich T.M., Maman M., Bennett E.R., Greenberg D.S., Meshorer E., Levanon E.Y., Soreq H, & Kadener S. (2020). A Parkinson's disease CircRNAs Resource reveals a link between circSLC8A1 and oxidative stress. EMBO Molecular Medicine, 12(9), e11942.
+ Open protocol
+ Expand
6

qRT-PCR Analysis of Rejection Genes

Check if the same lab product or an alternative is used in the 5 most similar protocols
Up to 1 μg RNA was converted to complementary DNA using an iScript select kit (Bio-Rad, Hemel Hempstead, UK) with random hexamer priming. qRT-PCR was carried out using an Applied Biosystems 7500 real-time qPCR machine. Ten nanograms complementary DNA was used in SYBR green assay (Agilent Technologies) with gene-specific primers spanning an intron for 18 genes (Supplemental Table 4)24 (link),28 (link). This selection of 18 genes represented genes in the Banff Molecular Working Group reference panel that were high-lighted in several publications as related to rejection, and in particular antibody-mediated rejection. Only 18 genes could be tested due to limited material available, so we restricted our choice to genes increased in antibody-mediated rejection, as these are the most likely to be clinically useful in the near future. Primers were designed to map to the same region of mRNA as the NanoString probe. Reactions were performed in triplicate at 95 °C for 10 min, followed by 40 cycles of 95 °C for 15 s, and 60 °C for 1 min. A threshold cycle (CT) was recorded in the exponential phase of amplification, and melt curves were created to confirm primer specificity (15 s 95 °C, 1 min 60 °C increasing at 0.05 °C/second to 95 °C for 15 s). Gene expression levels were normalised to housekeeping gene HPRT.
Toulza F., Dominy K., Cook T., Galliford J., Beadle J., McLean A, & Roufosse C. (2020). Technical considerations when designing a gene expression panel for renal transplant diagnosis. Scientific Reports, 10, 17909.
+ Open protocol
+ Expand
7

Insulin Receptor Cre/loxP Recombination Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was isolated from control and SNIRKO DRG to assess Cre/loxP recombination as described previously (Guerra et al., 2001 (link)). A reverse primer specific for exon 6 of the insulin receptor was used for reverse transcription: 5′-GTGATGGTGAGGTTGTGTTTGCTC-3′. The reaction was carried out using an iScript select kit (Bio-Rad) at 42 degrees for 30 min, followed by 85 degrees for 5 min. The generated cDNA was then used for PCR template. Primers to exon 3, 5′-GCTGCACAGCTGAAGGCCTGT-3′, and exon 5, 5′-CTCCTCGAATCAGATGTAGCT-3′ were used to amplify the region corresponding to exon 4. PCR conditions were 94° for 30 secs followed by 35 cycles of 94° for 30 secs, 58° for 30 secs, 72 °for 1 min and a final extension at 72° for 7 min. A 585bp fragment indicates an intact insulin receptor and a 435bp fragment indicates cre/loxp recombination and deletion of the 150bp exon 4.
Grote C.W., Wilson N.M., Katz N.K., Guilford B.L., Ryals J.M., Novikova L., Stehno-Bittel L, & Wright D.E. (2018). Deletion of the Insulin Receptor in Sensory Neurons Increases Pancreatic Insulin Levels. Experimental neurology, 305, 97-107.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!