We isolated DNA from 200 μl fluid samples (plasma, or urine), or 5 × 106 cells using the Qiamp Blood DNA Mini kit (Qiagen, Germantown, MD). We eluted the DNA in 50 μl DEPC water following an additional 5‐min incubation at room temperature. We tested the samples for rhCMV by QPCR using the Express QPCR Supermix Universal kit (ThermoFisher Scientific, Waltham, MA) on a LightCycler 96 (Roche, Indianapolis, IN). Cycling conditions were: 95°C for 5 min followed by 50 cycles of 95°C for 15 s, 60°C for 1 min, and 72°C for 1 s. We used primers targeting the rhCMV UL54 gene (23 ). The final concentration of each primer was 300 nm. Forward primer – 5‐′GATGGGACCGCTCAAGTTTC‐3′, reverse primer – 5′‐TGACGGTAGCGAGGAGACAA‐3′.
The final concentration of probe – (6FAM) GGTCGATGGGGTTTTGACTCACGA (BHQ1) was 100 nm. We determined the concentration of the rhCMV DNA in the samples by interpolating onto a standard curve created by tenfold serial dilutions of a fragment of the rhCMV UL54gene.
The final concentration of probe – (6FAM) GGTCGATGGGGTTTTGACTCACGA (BHQ1) was 100 nm. We determined the concentration of the rhCMV DNA in the samples by interpolating onto a standard curve created by tenfold serial dilutions of a fragment of the rhCMV UL54gene.