Abi 3130xl dna analyzer

The suggestive causative mutation for PRA2 in exon 8, TTC8_c.669delA, was screened in 2500 GRs by PCR amplification using fluorescent primers (Forward: 5′-6-FAM- TGCCCTTTCCACAGAGCAC-3′ and Reverse: 5′- CCATGTCTAAGCCCTTCACAA-3′; IDT, Glasgow, UK) and subsequent fragment length polymorphism detection using an ABI 3130xl DNA Analyzer and GeneMapper® Software (Applied Biosystems, Inc., [ABI], Foster City, CA). The panel of 2500 GRs of any age (including the 26 DNA samples already sequenced), was made up of 29 PRA cases, 5 obligate carriers, 459 clear dogs and 2007 dogs with unknown PRA clinical status. Included in this cohort of 2500 dogs were 88 dogs of breeding age (between one and eight years of age), unrelated at the parent level (from 88 different dams and 88 different sires) and of UK ancestry. Also included were 87 dogs of French ancestry, 736 dogs of Swedish ancestry, 132 dogs of Danish ancestry and 179 dogs of US ancestry, collected specifically for allele frequency estimations. In addition, samples from 175 dogs representing three breeds that are closely related to the GR breed were also included in the mutation screening: LR (n = 71), CBR (n = 45) and FCR (n = 59).

PCR was performed using Qiagen’s HotStarTaq DNA Polymerase kit with primers specific for the exogenous IDH1 (reverse primer binds on junction of exon 4 and 5) or both exogenous and endogenous copies (reverse primer binds within exon 4) (IDH1 DNA forward TTGATCCCCATAAGCATGA, IDH1 DNA and cDNA reverse TCCTGATGAGAAGAGGGTTGA, IDH1 cDNA forward TTGCTCTGTATTGATCCCCATA). The PCR was performed with the following program: denaturation at 95 °C for 15 min followed by 34 cycles of denaturation at 95 °C for 30 s, annealing at 57 °C for 30 s and extension at 72 °C for 45 s. A final elongation step of 72 °C for 10 min was added. The amplicons were run on a 2% agarose gel impregnated with GelRed at 110 V for one hour and photographed under UV light. The amplicons were sequenced using Sanger’s dye terminator method on the ABI 3130xl DNA Analyzer (Applied Biosystems, Foster City, CA, USA).