Parasite samples with P. falciparum confirmed by PCR following the methodology previously published [35 (link)] were selected for sequencing of antimalarial drug resistance loci including: pfmdr1 (PF3D7_0523000; including codons 86, 184 and 1246) and pfk13 (PF3D7_1343700; including codons from 412 to codon 723). Genes were PCR amplified following the methodology previously published [34 (link)] with modifications (primers and thermocycling conditions in Table S1 ) and products cleaned using SureClean (Bioline, USA) following manufacturer’s instructions. The PCR products were analyzed by electrophoresis on a 2% agarose gel stained with GreenSafe (Nzytech, Portugal) to confirm amplification. The PCR products were sequenced using Sanger capillary platform at Eurofins Genomics, Germany, and the resulting sequences were analyzed using BLAST: Basic Local Alignment Search Tool (https://blast.ncbi.nlm.nih.gov/Blast.cgi ; accessed on 18 August 2021). The laboratory-adapted 3D7 clone (MRA-102) was used as reference.
Greensafe
Manufactured by NZYTech
Sourced in Portugal
GreenSafe is a laboratory equipment product designed for safe and efficient handling of hazardous materials. The core function of GreenSafe is to provide a controlled environment for conducting experiments or processes involving potentially dangerous substances.
Automatically generated - may contain errors
Lab products found in correlation
Nzydna ladder 6, by NZYTech (2 mentions)
Thermal imaging system fti 500, by GE Healthcare (2 mentions)
Nanodrop 1000 spectrophotometer, by Thermo Fisher Scientific (2 mentions)
Sureclean, by Meridian Bioscience (1 mentions)
Tpersonal thermocycler, by Analytik Jena (1 mentions)
Taq polymerase enzyme, by Promega (1 mentions)
Deoxynucleotide triphosphate dntps, by Promega (1 mentions)
Mgcl2, by Promega (1 mentions)
Biotaq dna polymerase, by Meridian Bioscience (1 mentions)
Thermal cycler, by Bio-Rad (1 mentions)
Lightcycler 2.0 instrument, by Roche (1 mentions)
Trizol ls reagent, by Thermo Fisher Scientific (1 mentions)
Faststart dna master sybr green 1 kit, by Roche (1 mentions)
Moloney murine leukemia virus reverse transcriptase m mlv rt, by Thermo Fisher Scientific (1 mentions)
Etest strips, by bioMérieux (1 mentions)
Moloney murine leukemia virus reverse transcriptase, by Thermo Fisher Scientific (1 mentions)
Nzyol, by NZYTech (1 mentions)
Rq1 rnase free dnase, by Promega (1 mentions)
Api staph galleries, by bioMérieux (1 mentions)
Columbia agar, by bioMérieux (1 mentions)
15 protocols using greensafe
1
Sequencing of Antimalarial Drug Resistance Loci in Plasmodium falciparum
2
RNA Binding and Condensation Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The extent of RNA binding and condensation by the systems (CS-SA, PEI-SA, CS-SA-Lf, and PEI-SA-Lf) were investigated by agarose gel electrophoresis. Briefly, polyplexes were prepared at different N/P ratios, and, after centrifugation, 20 μL of each sample was loaded into individual wells of the 0.8% agarose gel in Tris-acetic acid buffer (40 mM Tris base, 20 mM acetic acid, and 1 mM EDTA, pH 8.0). The electrophoretic run was performed at 120 V for 50 min, and the bands corresponding to unbound RNA were visualized under ultraviolet light after staining the gels with 0.5 µg/mL greensafe (Nzytech, Lisbon, Portugal).
3
Molecular Characterization of Nematode Genomic DNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA was extracted from two female and two male worms using a standard nematode digestion protocol (Holterman et al. 2006 (link)). Two overlapping fragments of 18S rRNA genes (~1600 bp) were amplified from each specimen using primer sets 988F (5`-CTC AAA GAT TAA GCC ATG C-3`) and 1912R (5`-TTT ACG GTC AGA ACT AGG G-3)` for the first fragment, and 1813F (5`-CTG CGT GAG AGG TGA AAT-3`, 2646R 5`-GCT ACC TTG TTA CGA CTT TT-3`) for the second fragment (Holterman et al. 2006 (link)). The D2/D3 expansion segments of the 28S rRNA gene (~900 bp) were additionally amplified from all specimens using the primers D2A (5`-ACA AGT ACC GTG AGG GAA AGT TG-3`) and D3B (5`-TCG GAA GGA ACC AGC TAC TA-3`) (De Ley et al. 1999 ). Each PCR reaction was performed under the following conditions: initial denaturation 94 °C for 5 min; 40 cycles (denaturation 94 °C for 30 sec; primer annealing 50 °C for 30 sec; extension 72 °C for 1 min), and final extension 72 °C for 10 min. PCR products were visualized on 1% agarose gel with GreenSafe (NZYtech) under visible and UV light. Fragment size was determined using GeneRuler™ 100 bp Ladder Plus (Ferments, Thermo Scientific). The amplified products were sequenced by Eurofins MWG Operon.
4
Genotyping SLCO1B1 c.521T>C Variant
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The specific polymorphic variant of the SLCO1B1 gene, the c.521 T > C SNP analyzed in this study (GenBank accession no. NC_000012.10), was performed by a polymerase chain reaction-restriction fragment length polymorphism (PCR–RFLP) assay. PCR reaction volume was 25µL containing 1 µM of each assay-specific primers, 0.3 mM deoxynucleotide triphosphate (dNTPs) (Promega), 3 mM MgCl2 (Promega), 1.5 U Taq polymerase enzyme (Promega), 1 × PCR GoTaq Buffer Mix, water, and ≈ 1 µg genomic DNA. The PCR included 40 cycles at 94 °C for denaturation of the genomic DNA and activation of the Taq polymerase enzyme, 55 °C for annealing of the primers, and 72 °C for extension.
The PCR assay was performed using Tpersonal Thermocycler (Biometra), and finally, electrophoretic separation on 2% (W/V) agarose gel, with a running time of 90 min at 80 V in 1X TAE buffer (Tris–acetate-EDTA buffer; 40 mM Tris, 20 mM acetate, 1 mM EDTA), and visualization of the gel-separated PCR products with Green Safe (NZYTech) staining under UV light (AlphaImager, AlphaInnotech).
The PCR assay was performed using Tpersonal Thermocycler (Biometra), and finally, electrophoretic separation on 2% (W/V) agarose gel, with a running time of 90 min at 80 V in 1X TAE buffer (Tris–acetate-EDTA buffer; 40 mM Tris, 20 mM acetate, 1 mM EDTA), and visualization of the gel-separated PCR products with Green Safe (NZYTech) staining under UV light (AlphaImager, AlphaInnotech).
5
RAPD Screening of Metarhizium Genomes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Twenty-one random 10-mer oligo-nucleotide primers (Table 2 ) were used for RAPD M. luci (isolate PtL1) and M. ethiopica (isolate BrEt) genome screening to find DNA markers specific to M. luci.
PCR reactions were performed in 13 µL volume containing 10 ng of M. luci or M. ethiopica DNA, 1× buffer, 1.8 mM MgCl2, 0.2 mM dNTPs, 0.3 µM of primer and 2 U BioTaq DNA polymerase (Bioline). The amplifications were carried out in a thermal cycler (Bio-Rad) using the following conditions: an initial denaturation at 94 °C for 5 min, followed by 40 cycles of denaturation at 94 °C for 30 s, annealing at 39 °C for 45 s and extension at 72 °C for 2 min, and a final extension for 10 min at 72 °C. The PCR products were analyzed on 1.5 % agarose gel electrophoresis in 1× TBE buffer stained with GreenSafe (Nzytech). The experiment was repeated twice to confirm the reproducibility of the results.
PCR reactions were performed in 13 µL volume containing 10 ng of M. luci or M. ethiopica DNA, 1× buffer, 1.8 mM MgCl2, 0.2 mM dNTPs, 0.3 µM of primer and 2 U BioTaq DNA polymerase (Bioline). The amplifications were carried out in a thermal cycler (Bio-Rad) using the following conditions: an initial denaturation at 94 °C for 5 min, followed by 40 cycles of denaturation at 94 °C for 30 s, annealing at 39 °C for 45 s and extension at 72 °C for 2 min, and a final extension for 10 min at 72 °C. The PCR products were analyzed on 1.5 % agarose gel electrophoresis in 1× TBE buffer stained with GreenSafe (Nzytech). The experiment was repeated twice to confirm the reproducibility of the results.
6
Quantification of Epithelial-Mesenchymal Transition Markers
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The TRIzol LS reagent (Thermo Fisher Scientific, Waltham, MA, USA) was used to extract the cells’ total RNA following the product’s standard protocol. The RNA concentration was determined with Nanodrop 2000 spectrophotometer, and its integrity was verified by electrophoresis with 1.5% agarose gel in Tris-Borate buffer using GreenSafe (NZYTech, Lisboa, PT, Portugal). Complementary DNA (cDNA) from 1 µg of RNA was obtained using Moloney Murine Leukemia Virus Reverse Transcriptase (M-MLV RT, 28025013, Thermo Fisher Scientific) following the provider’s standard protocol. The 18S ribosomal RNA (rRNA) was used as the housekeeping gene. Quantitative reverse transcription-polymerase chain reaction (RT-qPCR) experiments were performed with the FastStart DNA Master SYBR Green I kit (Roche, Basel, Switzerland) in a LightCycler 2.0 instrument (Roche) to gene amplification. The used primers were TJP1 (tight junction protein 1): FW-5′-gccattcccgaaggagttga-3′, RV-5′-atcacagtgtggtaagcg-3′; CDH2 (cadherin-2): FW-5′-ctggagacattggggacttc-3′, RV-5′-gagccactgccttcatagt-3′; and VIM (vimentin): FW-5′-ggaccagctaaccaacgaca-3′, RV-5′-aaggtcaagacgtgccagag-3′. rRNA18S [FW-5′-agtgaaactgcgaatggctc-3′, RV-5′-ctgaccgggttggttttgat-3′]. Relative expression was quantified by the comparative 2∆∆Ct method [49 (link)].
7
Antimicrobial Susceptibility Testing of Staphylococcus
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Minimal inhibitory concentrations (MIC) were determined for antibiotics: cefoxitin (Fox), ceftaroline (Cpt), ciprofloxacin (Cip), clindamycin (Cli), doxycycline (Dox), erythromycin (Ery), gentamicin (Gen), linezolid (Lzd), meropenem (Mem) and vancomycin (Van), by placing e-test strips (Biomérieux) on staphylococci inoculated on Mueller Hinton plates, incubated for 24 h at 37 °C. Test performance was monitored using S. aureus ATCC 29213.
Detection of mecA gene was performed as previously described [23 ]. Amplified products were analysed by electrophoresis with 0.5X Tris-Borate-EDTA (TBE) buffer in a 1.5 % agarose gel (Bioline) stained with GreenSafe (NZYTech) and visualized by transillumination under UV (Pharmacia Biotech, Thermal Imaging System FTI-500). NZYDNA ladder VI (NZYTech) was used as molecular weight marker. MRSA control strain was kindly provided by Dr. Birgit Strommenger (Robert Koch Institute, Germany).
Staphylococci under analysis were defined as Methicillin Resistant Staphylococcus (MRS) if resistant by cefoxitin MIC or if mecA positive [28 ], and as Multi-drug Resistant (MDR) if resistant to three or more antimicrobials belonging to different antibiotic classes and bacterial targets [29 (link)].
Detection of mecA gene was performed as previously described [23 ]. Amplified products were analysed by electrophoresis with 0.5X Tris-Borate-EDTA (TBE) buffer in a 1.5 % agarose gel (Bioline) stained with GreenSafe (NZYTech) and visualized by transillumination under UV (Pharmacia Biotech, Thermal Imaging System FTI-500). NZYDNA ladder VI (NZYTech) was used as molecular weight marker. MRSA control strain was kindly provided by Dr. Birgit Strommenger (Robert Koch Institute, Germany).
Staphylococci under analysis were defined as Methicillin Resistant Staphylococcus (MRS) if resistant by cefoxitin MIC or if mecA positive [28 ], and as Multi-drug Resistant (MDR) if resistant to three or more antimicrobials belonging to different antibiotic classes and bacterial targets [29 (link)].
8
Transcriptomic Analysis of cdkl5 Mutants
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Pools of approximately 30 cdkl5sa21938 mutant embryos with 5 dpf were collected, sacrificed with a lethal concentration of anesthesia (MS22), and washed twice with PBS. Total RNA was extracted using NZYol (NZYTech) according to the manufacturer’s instructions and its quality was accessed through electrophoresis in an agarose gel stained with GreenSafe (NZYTech). At least three biological replicates were obtained from individual experiments. For reverse transcription, 1 µg of total RNA was subjected for 30 min at 37 °C to RQ1 RNase-free DNase (Promega) and cDNA was synthesized by the Moloney murine leukemia virus reverse transcriptase (Invitrogen) using an oligo-dT primer.
9
Rapid Staphylococcus Identification via PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
After inoculation in Columbia Agar + 5 % sheep blood (Biomerieux), plates were incubated at 37 °C for 24 h. Rapid DNA extraction was performed by suspending four to five bacterial colonies in 100 μL of TE (10 mM Tris, 1 mM EDTA, pH 7.8) buffer and heating to 97 °C for seven min. After centrifugation at 15 000 g for five min, supernatant was collected and stored at −20 °C for subsequent PCR screening.
Staphylococcus aureus and Staphylococcus epidermidis identification was confirmed using a multiplex PCR protocol described elsewhere [23 ]. Amplified products were analysed by electrophoresis using 0.5X Tris-Borate-EDTA (TBE) buffer in a 2 % agarose gel (Bioline) stained with GreenSafe (NZYTech) and visualized by transillumination under UV (Pharmacia Biotech, Thermal Imaging System FTI-500). NZYDNA ladder VI (NZYTech) was used as a molecular weight marker. S. aureus ATCC 29213 and S. epidermidis ATCC 35984 were used as PCR amplification controls.
For the remaining staphylococcal isolates, Biomerieux API Staph galleries were used for species identification.
Staphylococcus aureus and Staphylococcus epidermidis identification was confirmed using a multiplex PCR protocol described elsewhere [23 ]. Amplified products were analysed by electrophoresis using 0.5X Tris-Borate-EDTA (TBE) buffer in a 2 % agarose gel (Bioline) stained with GreenSafe (NZYTech) and visualized by transillumination under UV (Pharmacia Biotech, Thermal Imaging System FTI-500). NZYDNA ladder VI (NZYTech) was used as a molecular weight marker. S. aureus ATCC 29213 and S. epidermidis ATCC 35984 were used as PCR amplification controls.
For the remaining staphylococcal isolates, Biomerieux API Staph galleries were used for species identification.
10
Mitochondrial COI Gene Amplification and Sequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA was extracted from fin tissue using the Omega Bio-tek protocol (E.Z.N.A.® Tissue DNA Kit). Fragments of the mitochondrial gene cytochrome c oxidase subunit 1 (COI) were amplified with the primers FishF2 (5’ TCGACTAATCATAAAGATATCGGCAC 3’) and FishR2 (5’ ACTTCAGGGTGACCGAAGAATCAGAA 3’) (Ward et al. 2005 (link)). Polymerase chain reaction (PCR) for the sample comprised a total volume 12.5 μl, containing 1.25 μl of template DNA, 0.5 μM of the primers, 3.13 μl of Supreme NZYTaq 2x Green Master Mix (NZYTech) and ultrapure water up to 12.5 μl. The PCR cycles were as follows: an initial denaturation step at 95°C for 5 min, followed by 35 cycles of 95°C for 30 s, 53°C for 30 s, 72°C for 45 s and a final extension step at 72°C for 5 min (Bioer GeneExplorer™ PCR thermal cycler). The PCR product was run on 2% agarose gels stained with GreenSafe (NZYTech) and imaged under UV light to verify the amplicon size; then it was purified using magnetic beads (MagBind, Omega Bio-tek) prior to sequencing. Afterwards, the PCR product was bi-directionally sequenced on a ABI 3730xl DNA Analyzer (Applied Biosystems, USA), with the same primers as those used in the PCR amplification. Several sequencing runs were performed in order to improve the quality of the sequence data.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!