Chloramphenicol cam

Chromosomal integration of mCherry into S. aureus strain N315 [34 (link)] was performed using the methodology outlined by De Jong et al. [35 (link)]. Briefly, the mCherry harbouring plasmid pRN111 was isolated from E. coli strain DC10B and electroporated into electrocompetent S. aureus N315. Transformants containing the plasmid were selected on tryptone soy agar (TSA) containing 10 µg ml⁻¹ chloramphenicol (Cam, Sigma) and incubated for 24–48 h at 30 °C. Single crossover events through homologous recombination were generated via two rounds of plating onto TSA containing 7.5 µg ml⁻¹ Cam followed by incubation at 42 °C overnight. Single recombinants were inoculated into 5 ml tryptone soy broth without antibiotics and incubated at 30 °C, 200 r.p.m. overnight. Cultures were diluted 1 in 1000 for five passages to promote double crossover events. Planktonic bacteria were plated onto TSA with 200 ng ml⁻¹ anhydrotetracycline (ATc, Sigma) and incubated overnight at 37 °C. Integrated mutants were screened by patch plating colonies onto both TSA with and without 10 µg ml⁻¹ Cam. Colonies that demonstrated the correct phenotype were screened for successful mCherry integration by PCR using primers mCherry_OUT_F: TACGACAATTCAAGAGCTTGC and mCherry_OUT_R: GAGTAAGCCAGAACAGTTCC alongside whole-genome sequencing (MicrobesNG, Birmingham UK).