The largest database of trusted experimental protocols

9 protocols using pcs2tal3rr

1

A20 Regulation of NF-κB Signaling

Check if the same lab product or an alternative is used in the 5 most similar protocols
Anti-FLAG antibody was purchased from Sigma (St. Louis, MO); anti-HA and anti-phospho-IκBα antibodies were purchased from Cell Signaling (Danvers, MA); anti-β-actin antibody was purchased from Abcam (Cambridge, MA); anti-A20 antibody was purchased from Ebioscience (San Diego, CA). HEK293T cell line was purchased and maintained per instructions from American Type Culture Collection (ATCC; Manassas, VA). Golden Gate cloning kit and expression vectors, pCS2TAL3DD and pCS2TAL3RR, were purchased from Addgene (Cambridge, MA). DH5α competent cells were purchased from Life Technologies (Grand Island, NY). QuantiTect SYBR Green PCR Master Mix was purchased from QIAGEN (Valencia, CA). Restriction enzymes NlaIII, EcoRV, and NEB Standard Buffer 4 were purchased from New England Biolabs (Ipswich, MA).
+ Open protocol
+ Expand
2

TALEN Design and Construction for pcgf1 Gene

Check if the same lab product or an alternative is used in the 5 most similar protocols
The pcgf1 TALEN target site was selected using the online TAL Effector-Nucleotide Targeter tool (https://tale-nt.cac.cornell.edu/; [35 (link)]) in exon 2 with the following parameters: (i) spacer length of 14–17 bp, (ii) repeat array length of 16–18 bp, (iii) each binding site was anchored by a preceding T base in position ‘‘0” as has been shown to be optimal for naturally occurring TAL proteins [36 (link), 37 (link)], (iv) presence of a restriction site (ClaI) within the spacer sequence for screening and genotyping purposes.
Pcgf1-specific TALEN constructs were engineered using the TALEN Golden Gate assembly system described by Cermak et al., [38 (link)]. The TALEN expression backbones, pCS2TAL3DD and pCS2TAL3RR [27 (link)], and the plasmids providing repeat variable diresidues (RVD) [38 (link)] for Golden Gate Cloning were obtained from Addgene.
+ Open protocol
+ Expand
3

TALEN Design for Targeting kif6 Exon

Check if the same lab product or an alternative is used in the 5 most similar protocols
Two TALENs (left and right) were designed to target the second exon of kif6. These sites flanked a BccI restriction site that was used for mutation screening. TALENs were generated using the Golden Gate method as previously described (Cermak et al., 2011 (link)). Plasmids were acquired from the Golden Gate TALEN and TAL Effector Kit (AddGene) and RVD repeat arrays were cloned into pCS2TAL3DD and pCS2TAL3RR (AddGene). Plasmids were transformed into DH5a competent cells (Invitrogen) and isolated using the QIAprep Spin Miniprep Kit (Qiagen). The following sequence targets and RVD sites were used to generate kif6 TALENs: Left target DNA TCCCTCTTATTGTTG, LeftRVDsequence NGHDHDHDNGHD NGNGNINGNGNNNGNGNN Right target DNA GCATCTCTGGGAACC RightRVDsequence NNNNNGNGHDHDHDNINN NINNNINGNNHD
+ Open protocol
+ Expand
4

Targeted Genomic Editing with TALENs

Check if the same lab product or an alternative is used in the 5 most similar protocols
Genomic DNA sequence surrounding the TT>A enhancer was scanned for potential TALEN target sites using TALEN-Targeter 2.0 (27 (link)). A modified TALEN Golden Gate assembly system (Addgene, Cambridge, MA) was then used to generate repeat variable di-residue (RVD) arrays to target the TT>A enhancer. The RVD sequence was subcloned into the expression vectors pCS2TAL3DD (5’ arm) and pCS2TAL3RR (3’ arm) (Addgene, Cambridge MA). Sanger sequencing confirmed the correct insertion into each expression vector (31 (link), 32 (link)). TALENs were expressed in HEK293T cells by transient transfection using Fugene HD (VWR, Radnor, PA) with 2 µg of each plasmid DNA encoding HA-tagged 5’-arm and FLAG-tagged 3’-arm. After 48 h, protein expressions of 5’ and 3’ TALEN arms were detected using Western blotting with antibodies against the respective HA (5’ arm) and FLAG (3’ arm) tags. Single cell clones of the HEK293T cells expressing TALENs were isolated and genomic DNA harvested by phenol-chloroform extraction. The genomic DNA of the TT>A enhancer in each cell clone was amplified with PCR (Supplemental Table 1) and screened using high-resolution melting curve analysis (28 (link)). PCR amplicon sequences from each clone were further validated by Sanger sequencing (31 (link), 32 (link)).
+ Open protocol
+ Expand
5

A20 Regulation of NF-κB Signaling

Check if the same lab product or an alternative is used in the 5 most similar protocols
Anti-FLAG antibody was purchased from Sigma (St. Louis, MO); anti-HA and anti-phospho-IκBα antibodies were purchased from Cell Signaling (Danvers, MA); anti-β-actin antibody was purchased from Abcam (Cambridge, MA); anti-A20 antibody was purchased from Ebioscience (San Diego, CA). HEK293T cell line was purchased and maintained per instructions from American Type Culture Collection (ATCC; Manassas, VA). Golden Gate cloning kit and expression vectors, pCS2TAL3DD and pCS2TAL3RR, were purchased from Addgene (Cambridge, MA). DH5α competent cells were purchased from Life Technologies (Grand Island, NY). QuantiTect SYBR Green PCR Master Mix was purchased from QIAGEN (Valencia, CA). Restriction enzymes NlaIII, EcoRV, and NEB Standard Buffer 4 were purchased from New England Biolabs (Ipswich, MA).
+ Open protocol
+ Expand
6

TALEN-Mediated Editing of ctnna1 Locus

Check if the same lab product or an alternative is used in the 5 most similar protocols
TALENs targeting the ctnna1 locus were designed using the TALE-NT tool (https://tale-nt.cac.cornell.edu/node/add/talen) using the guidelines specified in Cermak et al. (2011) (link). The chosen optimal target sequence in exon 3: 5′- TTGTGTTTATTGCAGGTCACCACACTTGTGAACTCCAGCAACAAAGGTCCA-3′ (binding sites of the left and right TALEN arms are underlined) contains a HphI (NEB) restriction enzyme site (GGTGA). TALENs were generated using the Golden Gate kit (Cermak et al., 2011 (link)) in combination with the obligate heterodimeric FokI pCS2TAL3DD (Addgene, #37275) and pCS2TAL3RR (Addgene, #37276) backbones (Ota et al., 2013 (link)).
TALEN targeting plasmids were linearized with NotI (Promega) after which IVT mRNA was generated using the mMessage mMachine SP6 kit (Ambion), and purified using the RNeasy mini kit (Qiagen).
+ Open protocol
+ Expand
7

TALEN Design and Synthesis for vcla

Check if the same lab product or an alternative is used in the 5 most similar protocols
TALENs targeting the vcla locus were designed using the TALE-NT tool (https://tale-nt.cac.cornell.edu/node/add/talen) using the guidelines specified in [41 (link)]. The chosen optimal target sequence in exon 4:
5’-TTGTGGAAACCATGGAGGACTTGATCACTTACACTAAAAACCTGGGACCAGGTA-3’ (binding sites of the Left and Right TALEN arms are underlined) contains a BclI (Promega) restriction enzyme site (TGATCA). TALENs were generated using the Golden Gate kit in combination with the obligate heterodimeric FokI pCS2TAL3DD (Addgene, #37275) and pCS2TAL3RR (Addgene, #37276) backbones [42 (link)].
TALEN targeting plasmids were linearized with NotI (Promega) after which IVT mRNA was generated using the mMessage mMachine SP6 kit (Ambion), and purified using the RNeasy mini kit (Qiagen).
+ Open protocol
+ Expand
8

Targeted Genomic Editing with TALENs

Check if the same lab product or an alternative is used in the 5 most similar protocols
Genomic DNA sequence surrounding the TT>A enhancer was scanned for potential TALEN target sites using TALEN-Targeter 2.0 (27 (link)). A modified TALEN Golden Gate assembly system (Addgene, Cambridge, MA) was then used to generate repeat variable di-residue (RVD) arrays to target the TT>A enhancer. The RVD sequence was subcloned into the expression vectors pCS2TAL3DD (5’ arm) and pCS2TAL3RR (3’ arm) (Addgene, Cambridge MA). Sanger sequencing confirmed the correct insertion into each expression vector (31 (link), 32 (link)). TALENs were expressed in HEK293T cells by transient transfection using Fugene HD (VWR, Radnor, PA) with 2 µg of each plasmid DNA encoding HA-tagged 5’-arm and FLAG-tagged 3’-arm. After 48 h, protein expressions of 5’ and 3’ TALEN arms were detected using Western blotting with antibodies against the respective HA (5’ arm) and FLAG (3’ arm) tags. Single cell clones of the HEK293T cells expressing TALENs were isolated and genomic DNA harvested by phenol-chloroform extraction. The genomic DNA of the TT>A enhancer in each cell clone was amplified with PCR (Supplemental Table 1) and screened using high-resolution melting curve analysis (28 (link)). PCR amplicon sequences from each clone were further validated by Sanger sequencing (31 (link), 32 (link)).
+ Open protocol
+ Expand
9

TALEN-mediated Genome Editing in Zebrafish

Check if the same lab product or an alternative is used in the 5 most similar protocols
Left and right TALENs were designed to target the sites flanking codon 673 of smyhc1, on exon 16. TALENs were generated using the Golden Gate method as previously described (Cermak et al, 2011). Plasmids were acquired from the Golden Gate TALEN and TAL Effector Kit (AddGene) and RVD repeat arrays were cloned into pCS2TAL3DD and pCS2TAL3RR (AddGene). Plasmids were transformed into DH5α competent cells (Invitrogen) and isolated using the QIAprep Spin Miniprep Kit (Qiagen).
Subsequently, plasmids encoding the scaffold and RVD arrays were linearized via restriction digest and 5′‐capped mRNA was generated by in vitro transcription using the mMESSAGE mMACHINE SP6 Transcription Kit (Life Technologies). Capped mRNA was purified using the RNeasy Mini Kit (Qiagen). WT embryos were collected, and 40–50 pg of pooled left and right TALENs at equal concentrations were injected into the yolk of 1–4 cell stage embryos. Embryos were raised to adulthood, and sperm and progeny of these fish were collected and sequenced with MiSeq to screen for germline transmission.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!