The following reagents were obtained: human embryonic kidney (HEK)-Blue-mTLR4 cells (Invivogen, San Diego, CA), Quanti-Blue medium (Invivogen), Escherichia coli LPS (Sigma, St. Louis, MO), Histogene laser capture microdissection (LCM) staining kit and Picopure RNA isolation kit (Arcturus; Life Technologies Corporation, Carlsbad, CA), Sensiscript RT kit, QIAamp DNA Stool Mini Kit, and QuantiFast SYBR Green Polymerase Chain Reaction (PCR) Kit (Qiagen, Valencia, CA), and stress-activated protein kinase/c-Jun N-terminal kinase (JNK) inhibitor (SP600125; Sigma Aldrich, St. Louis, MO). All other reagents were obtained from Sigma.
Quantifast sybr green polymerase chain reaction kit
Manufactured by Qiagen
The QuantiFast SYBR Green Polymerase Chain Reaction (PCR) Kit is a reagent kit designed for real-time PCR analysis. It contains a fast-acting SYBR Green-based master mix that enables rapid amplification and detection of DNA targets.
Automatically generated - may contain errors
Lab products found in correlation
Jnk inhibitor sp600125, by Merck Group (1 mentions)
Sensiscript rt kit, by Qiagen (1 mentions)
Escherichia coli lps, by Merck Group (1 mentions)
Hek blue mtlr4 cells, by InvivoGen (1 mentions)
Quanti blue medium, by InvivoGen (1 mentions)
Picopure rna isolation kit, by Thermo Fisher Scientific (1 mentions)
Qiaamp dna stool mini kit, by Qiagen (1 mentions)
Thermal cycler dice real time system tp800, by Takara Bio (1 mentions)
Quantitect reverse transcription kit, by Qiagen (1 mentions)
Rneasy mini kit, by Qiagen (1 mentions)
Rnase free dnase set, by Qiagen (1 mentions)
2 protocols using quantifast sybr green polymerase chain reaction kit
1
Quantitative Analysis of TLR4 Signaling
2
Quantitative RT-PCR analysis of CYP genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using an RNeasy Mini kit (Qiagen, Hilden, Germany) and DNA was on-column digested using RNase-free DNase Set (Qiagen) during total RNA extraction. cDNA was synthesized from total RNA using a QuantiTect Reverse Transcription kit (Qiagen). The synthesized cDNA was amplified using a QuantiFast SYBR Green polymerase chain reaction (PCR) kit (QIAGEN). Primer sequences were as follows: CYP1A1-F, 5′-CACCATCCCCCACAGCAC-3′; CYP1A1-R, 5′-ACAAAGACACAACGCCCCTT-3′; CYP1B1-F, 5′- CTGGCACTGACGACGCCAAGAGACT -3′; CYP1B1-R, 5′-TGGTCTGCTGGATGGACAGCGGGTT-3′; CYP1A2-F, 5′-CCAACGTCATTGGTGCCATG-3′; CYP1A2-R, 5′-GTGATGTCCCGGACACTGTTC-3′; β2-microglobulin (β2M)-F, 5′-ACTGAATTCACCCCCACTGA-3′; β2M-R, 5′-CCTCCATGATGCTGCTTACA-3′. PCR was performed using a Thermal Cycler Dice Real Time System TP800 (Takara). The mRNA levels were normalized against β2M mRNA.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!