Pclone007 vector

F81 cells and HEK-293T cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% fetal bovine serum (FBS) in 5% CO₂ at 37 °C. The CanineCV-DG strain was obtained from previous studies [40 (link)]. CPV-2 and SeV were stored in our laboratory. The pClone007 vector was purchased from Tsingke Biotechnology Co., Ltd. The empty p3×Flag-CMV10 and pEGFP-C3 vectors and the pBlueScript II SK (+) vector were purchased from Wuhan Miaoling Biotechnology (Wuhan, China). The pMD18-T clone vector was purchased from Takara Biomedical Co., Ltd. Technology (Beijing, China). The main ORFs of the virus were cloned and then ligated into the p3×Flag-CMV10 and pEGFP-C3 vectors. The feline interferon-associated luciferase reporter plasmids (IFN-β-Luc, NFκB-Luc, IRF3-Luc, and AP1-Luc) have been described in previous studies [41 (link),42 (link)].

The sequence of the compound heterozygous mutation (c.1155G > C and c.330 + 1G > A) was amplified from the genomic DNA of the proband (II-1) in family 3 and cloned into the pClone007 vector according to the manufacturer’s protocol (Tsingke).

HESPs from R. pedestris and P. apterus were silenced using RNAi. To minimize the non-target effect of RNAi, the target genes were searched against the transcriptomic and genomic database of R. pedestris or P. apterus, and the specific regions of the target genes were selected for dsRNA synthesis. The DNA sequences of target genes were amplified using the primers listed in Supplementary Table 7, and later cloned into pClone007 Vector (Tsingke, Beijing, China). Meanwhile, the recombinant plasmids were amplified using the primers containing T7 sequences, and the PCR-generated DNA templates were adopted to synthesize the double-stranded RNAs (dsRNAs) using a T7 High Yield RNA Transcription Kit (Vazyme, Nanjing, China).
RNAi experiments were performed as previously described^{45 (link)}. Briefly, the dsRNA was loaded into a capillary tube using tips. The R. pedestris and P. apterus that were pre-anaesthetized with carbon dioxide were placed on the plate constantly releasing carbon dioxide. Thereafter, dsRNA was injected into the insect mesothorax using FemtoJet (Eppendorf-Netheler-Hinz, Hamburg, Germany). Then, the treated insects were reared on soybean seeds or clover seeds, respectively. The silencing efficiency was determined at four days post-injection using the qRT-PCR.

To confirm the DNA methylation state, bisulfite sequencing was performed using the EZ DNA methylation kit (Zymo Research) following the manufacturer’s manual. Primers for bisulfite sequencing used in this study were as follows: H19 (Forward-TATGAGTATTTAGGAGGTAT AAGAATT, Reverse-TTTTATCAAAAACTAACATAAACCCCT); H19 nest (Forward-TGTAAGGAGATTATGTTTTATTTTTGG, Reverse-CCCTAACCTCATAAAACCCATAAC TAT); Snrpn (Forward-TATGAGTATTTAGGAGGTATAAGAATT, Reverse-AATAAACCC AAATCTAAAATATTTTAATC); Snrpn nest (Forward-AATTTGTGTGATGTTTGTAATTAT TTGG, Reverse-ATAAAATACACTTTCACTACTAAAATCC). To determine the methylation state of individual CpG sites, the PCR product was extracted from the agarose gel, subcloned into a pClone007 vector (TSINGKE), and then sequenced for subsequent analysis.

To obtain the full-length sequence of the NORSF transcript, RACE assays were performed using the SMARTer® RACE 5′/3′ kit (#634858, Clontech Laboratories, Mountain View, USA). Briefly, 1 μg of high-integrity total RNA from sow GCs was used as a template to synthesize first-strand cDNA. Gene-specific primers were prepared as follows: 5′-CCG CCT CGG CTT CCT ACT AAA TCA CC-3′ (the reversed primer for 5′-RACE assay) and 5′-AGG GGG TGA TTT AGT AGG AAG CCG AGG-3′ (the forward primer for 3′-RACE assay). The 5′-RACE nested reverse primer is 5′-TCG CTT CCC TGT CAG AAT GTG-3′. The 3′-RACE nested forward primer is 5′-CAA CGC AGA GAA GAC CGA AAG-3′. PCR products were isolated using with a 1.5% agarose gel, and purified using a DNA Gel Extraction kit (#GE0101-200; TsingKe); subsequently, they were inserted into pClone007 vector (#TSV-007S; TsingKe) for sequencing.

To investigate the function of two putative splice-site mutations, TA cloning sequencing was performed on cDNA from the couple (I-1 and I-2). The PCR products were purified and cloned into pClone007 vector (TsingKe Biotechnology, Beijing, China). The recombinant vectors were transformed into TreliefTM5α-competent cells (TsingKe Biotechnology, Beijing, China) and ten monoclonal colonies were sequenced. The primers are listed in Table 1 (Primer #2 and Primer #3).

The 5mC levels of promoters of tomato ALKBHs in the fruit of wild type at various ripening stages and the fruit of Cnr or sldml2 mutant were analyzed on the base of tomato epigenome database (http://ted.bti.cornell.edu/epigenome/) or tomato DNA methylome database produced by Lang et al. [38 (link)].
The 5mC levels of SlALKBH2 promoter in N. benthamiana were assessed as previously described with minor modifications [84 (link)]. In brief, genomic DNA was extracted from the agroinfiltrated N. benthamiana leaves, and 500 ng of purified DNA was treated with bisulfite to produce mutations from cytosine (C) to thymine (T) using EZ DNA methylation-gold kit (ZYMO Research, D5005). Then, 100 ng of mutated DNA was used as templates for PCR amplification with the primers F (5′-GTCAACTTAGATGATACGTAGAGACATTG-3′) and R (5′-CACAACCATGTACACACATGG-3′). The PCR products were cloned into pClone007 vector (TSINGKE, NMBV-007S), and at least 20 positive clones were detected by Sanger bisulfite sequencing. The sequencing results were analyzed on Kismeth (http://katahdin.mssm.edu/) to calculate the 5mC level based on the ratio of C-T mutations in each C site.