Micromanipulator

FTW-mXEN injection into mouse blastocysts was performed as described previously(Yu et al., 2021b (link)) with slight modifications. Briefly, single cell suspensions of mouse and human FTW-mXENs were added to a 40 μL droplet of KSOM-HEPES containing the blastocysts and placed on an inverted microscope (Nikon) fitted with micromanipulators (Narishige). Individual cells were collected into a micropipette with 15–20 μm internal diameter (ID), and a Piezo Micro Manipulator (Prime Tech) was used to create a hole in the zona pellucida and trophectoderm layer of mouse blastocysts. 10–12 (FTW-mXEN/FTW-mTSCs) cells were introduced into the blastocoel. After microinjection, the blastocysts were cultured in mKSOMaa. For mouse embryo transfer, 8–12 weeks old ICR female mice were used as surrogates and were mated with vasectomized ICR male mice to induce pseudopregnancy. Ketamine (30 mg/ml) / Xylazine (4 mg/mL) and Buprenorphine (1 mg/mL) were used in surgery for maintaining anesthesia and relieving pain. Injected blastocysts were transferred to the surrogate uterine at E2.5. 14–30 blastocysts were transferred within 20–30 min per surrogate.

B6D2F1 females were superovulated by intraperitoneal injection of 5 i.U. Pregnant Mare Serum (PMS) and human Chorionic Gonadotropin (hCG). Oocytes were isolated from the oviducts 15 h after the last hormone injection and freed from cumulus cells by treatment with hyaluronidase. Testicular sperm were isolated from 8–13 week-old males as described [53 (link)]. Briefly, after removal of the tunica albuginea, testes were placed into 1% (m/v) PVP solution (P5288, Sigma) and cut into minute pieces. One part of the testicular suspension was throughout mixed with two parts 12% PVP solution and incubated at 16 °C until injection.
ICSI was performed at 17 °C using an inverted microscope (Leica, Wetzlar, Germany) equipped with micromanipulators (Narishige, Tokyo, Japan) and a piezo element (Eppendorf, Hamburg, Germany). Injection capillaries (PIEZO 8-15-NS, Origio, Charlottesville, VA, USA) were filled with Fluorinert (FC-770, Sigma) for proper Piezo pulse propagation. Testicular sperm were collected and injected into oocytes as described in detail by Yoshida et al. [54 (link)] with minor modifications. Here, testicular sperm were injected head to tail without prior removal of the sperm flagellum. Oocytes were cultured in M2 medium (Sigma) for injection. Surviving oocytes were cultivated in a drop-culture of KSOM (Gynemed, Lensahn, Germany) under mineral oil (Gynemed) at 37 °C and 5% CO₂.

For zygote microinjection, presumptive embryos were used ~14 h post insemination/activation. For MII microinjection, oocytes were denuded of COCs by vortexing in SOF-Hepes with 1 mg/mL of hyaluronidase for 4 min. Microinjection was performed using an inverted microscope (Nikon, Tokyo, Japan) fitted with micromanipulators (Narishige, Tokyo, Japan) and two hydraulic oil microinjectors (Eppendorf, Hamburg, Germany). Cas9 mRNA (Sigma, 100 ng/µL) and sgRNA (50 ng/µL) were mixed and loaded to a 5–7 µm internal diameter blunt-end micropipette. Zygotes and MII oocytes were placed in 50 µL drops of SOF-Hepes supplemented with 10% of FBS, secured by a holding pipette and sgRNA and Cas9 mRNA were intra-cytoplasmically injected (5–10 pL) assisted by laser zona pellucida ablation (Saturn 5, RI, UK). The cytoplasm of the oocyte/zygote was aspirated by applying negative pressure to ensure membrane breakage³² . After microinjection zygotes were returned to culture conditions and MII oocytes were in vitro fertilized or activated. All the microinjections were performed in groups of 25 and each session was limited to 30 min.

Mad2 (5′-ATGGCACAGCAGCTCGCCCGAGAGC-3′) and Mad2 5-base mismatch (ATGGCGCTGCAGCTCTCCCGGGAGC) morpholinos (Gene Tools LLC, USA)34 (link), were diluted in water, and introduced into oocytes by microinjection at tip concentrations of 1 mM. Microinjections into oocytes were performed on the stage of an inverted TE300 microscope (Nikon, Japan), at room temperature, using micromanipulators (Narishige, Japan). A single injection with a 0.1–0.3% volume was achieved using timed injection on a Pneumatic Picopump (World Precision Instruments, UK)38 (link). Oocytes were incubated in MEM media with 5% CO₂ for 24 h to allow for protein knockdown.

The acquired pronuclear embryos were immediately microinjected and cultured in vitro at 38.5 °C in a chamber with 5% CO₂ and a humidified atmosphere within 30 min. Microinjection was performed with an inverted microscope equipped with a pair of micro manipulators (Narishige, Tokyo, Japan). Fertilized eggs were microinjected with two to five pL of Tris-EDTA (TE) solution containing 50 ng/μL of sgRNA and 100 ng/μL of Cas9 mRNA, then linearized DNA solution was injected with five pL of pBC1-AANAT at a concentration of 10 ng/μL. After microinjection, four to six embryos were transplanted into the recipient oviducts within 2 h, and the remaining embryos were vitrified for further study.

Adult N. vectensis polyps were kept in the dark at 18°C in Nematostella medium (16‰ artificial seawater, NM) and induced for spawning in a 25°C incubator with 10 hr of constant illumination. Egg packages were fertilized for 30 min, de-jellied in 3% L-cysteine/NM, and washed six times with NM. Microinjection was carried out under a Nikon TS100F Microscope using an Eppendorf Femtojet and Narishige micromanipulators as described in Renfer and Technau, 2017 (link).
Adult TE zebrafish were kept in accordance with the guidelines of the EU directive 2010/63/EU and the German Animal Welfare Act as approved by the local authorities represented by the Regierungspräsidium Tübingen and the Regierungspräsidium Freiburg (Baden-Württemberg, Germany). Zebrafish embryos were maintained at 28°C in embryo medium (250 mg/l Instant Ocean salt in reverse osmosis water adjusted to pH 7 with NaHCO₃). Microinjections were carried out using PV820 Pneumatic PicoPumps (World Precision Instruments), M-152 micromanipulators (Narishige), and 1B100f-4 capillaries (World Precision Instruments) shaped with a P-1000 micropipette puller (Sutter Instrument Company).