DNAiso reagent (TaKaRa, Otsu, Shiga, Japan) was used to extract total DNA from frozen liver samples. The relative content of mtDNA was determined by co-amplifying mt D-loop and β-actin according to the method in a previous study [37 ]. Real-time PCR was conducted by using an ABI StepOnePlus™ Real-Time PCR system (Applied Biosystems, Foster City, CA, USA). The reaction system was 20 µL in total, which consisted of 1 µL of forward primer, 1 µL of reverse primer, 8 µL of TaqMan Universal Master Mix (TaKaRa, Otsu, Shiga, Japan), 1 µL of probes, 1 µL of enhance solution, 1 µL of DNA template, and 7 µL of double-distilled water. The reaction conditions were as follows: 10 s at 95℃, 50 cycles of 5 s at 95℃, 25 s at 60℃, and 10 s at 95℃. The 2-ΔΔCt method was used to calculate the relative mtDNA content [37 ]. The primer sequences used to measure the content of mtDNA are shown in Table 2 .
Taqman universal master mix
Manufactured by Takara Bio
Sourced in Japan
TaqMan Universal Master Mix is a pre-optimized, ready-to-use solution for real-time PCR applications. It contains all the necessary components, including a thermostable DNA polymerase, dNTPs, MgCl2, and buffer, to perform quantitative, gene expression, and allelic discrimination experiments.
Automatically generated - may contain errors
3 protocols using taqman universal master mix
1
Quantifying Mitochondrial DNA Content
2
Quantifying Mitochondrial Function and Copy Number in UCMSCs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
5 × 106 UCMSCs and F-Mito from 5 × 106 UCMSCs were used to measure Citrate synthase activity or mitochondria complex Ⅳ activity respectively. Citrate synthase (CS) activity was measured by citroyl synthetase kit (Nanjing Jiancheng Bioengineering Institute, Cat No. A108-1) according to the manufacturer’s instructions. And mitochondria complex Ⅳ activity was measured by Mitochondria Complex Ⅳ kit (MLBIO, Cat No. mI076308).
1 × 106 UCMSCs were used to extract DNA by DNA extraction kit (TIANGEN, Cat No. YDP304-03). mtDNA copy number was determined in triplicates, on two plates in parallel, using multiplex qPCR chemistry that simultaneously amplifies a mitochondrial (ND1) and a nuclear (RNAseP) amplicon to determine their relative abundance (Picard et al., 2018 (link)). The sequences for the ND1 amplicon are as follows:
Forward primer (300 nM), 5′CCCTAAAACCCGCCACATCT3’;
Reverse primer (300 nM): 5′GAGCGATGGTGAGAGCTAAGGT3’; and Probe (100 nM): 5′FAM-CCATCACCCTCTACATCACCGCCC-TAMRA3’.
The RNAseP assay is VIC-labeled and commercially available as a kit (Thermo, Cat No.4403328). Taqman Universal Mastermix (Takara, CatNo. RR390A) was used and the assay ran on a Quantstudio 5 real-time PCR thermocycler. mtDNA copy number was calculated as mtDNAcn = [2(RNAseP Ct - ND1 Ct)] × 2.
1 × 106 UCMSCs were used to extract DNA by DNA extraction kit (TIANGEN, Cat No. YDP304-03). mtDNA copy number was determined in triplicates, on two plates in parallel, using multiplex qPCR chemistry that simultaneously amplifies a mitochondrial (ND1) and a nuclear (RNAseP) amplicon to determine their relative abundance (Picard et al., 2018 (link)). The sequences for the ND1 amplicon are as follows:
Forward primer (300 nM), 5′CCCTAAAACCCGCCACATCT3’;
Reverse primer (300 nM): 5′GAGCGATGGTGAGAGCTAAGGT3’; and Probe (100 nM): 5′FAM-CCATCACCCTCTACATCACCGCCC-TAMRA3’.
The RNAseP assay is VIC-labeled and commercially available as a kit (Thermo, Cat No.4403328). Taqman Universal Mastermix (Takara, CatNo. RR390A) was used and the assay ran on a Quantstudio 5 real-time PCR thermocycler. mtDNA copy number was calculated as mtDNAcn = [2(RNAseP Ct - ND1 Ct)] × 2.
3
HCMV Detection via Real-Time PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Extracted DNA of plasma samples was subjected to TaqMan® real-time PCR targeting the UL83 gene, with the primers and probe proposed by Khansarinejad et al. (33 (link)). The sequence of the forward primer was 5′-TGAACATCCCCAGCATCAACG-3′, of the reverse primer was 5′-CAGTCCCGAGACMGTGAGAC-3′, and of the probe was 5′-FAM TGCCACATCTGCTTGCCCGACGC-BHQ1-3´. These primers and probe amplified the 137 bp segment of the UL83 gene in HCMV. Internal control of DNA extraction and PCR amplification was conducted by amplification of the human β globin gene. The primers consisted of the following sequences: forward primer: 5′-CAGAGCCATCTATTGCTTAC-3′, reverse primer: 5′-CATGGTGTCTGTTTGAGGTT-3′, and probe: 5′-JOE-ACACAACTGTGTTCACTAGC-BHQ1-3′ (34 (link)). All primers and probes were purchased from Bioneer Co., Ltd. (Daejeon, Korea). Real-time PCR was performed with TaqMan universal master mix (Takara Bio, Shiga, Japan). DNA was added to a 25 PCR mixture containing 12.5 μL of TaqMan universal PCR master mix, 300 nM of each primer, and 200 nM of probe. The reaction consisted of 10 minutes at 95°C, followed by 40 cycles of amplification, including 15 s at 95°C and 1 minute at 60°C.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!