5 6 fam

ZIKV RNA levels in serum and organs were quantified using the qScript One-Step RT-qPCR Kit (QuantaBio Cat# 96057-200) with ZIKV 1086 and ZIKV 1162c primers with ZIKV 1107 probe ໿(5′-6-FAM- AGCCTACCTTGACAAGCAGTCAGACAC TCAA-3′-BHQ-1 from Integrated DNA Technologies) as described previously [18] (link). RNA standards produced from in vitro transcription of primer and probe target regions were used to generate a standard curve for quantification. All qRT-PCR was performed and analysed using a LightCycler 480 RT-qPCR system (Roche) and LightCycler 480 software (Roche) respectively.

The recombinant TDP1 was purified as described below. The TDP1-biosensor 5′-(5,6 FAM-aac gtc agg gtc ttc c-BHQ1)-3′ was purchased from Integrated DNA Technologies; 5,6 FAM is fluorophore 5(6)-carboxyfluorescein, and BHQ1 is fluorescence quencher Black Hole Quencher 1. As described in detail previously [31 (link)], the TDP1-biosensor, with a final concentration of 50 nM, was incubated in a volume of 200 µL containing a TDP1 buffer (50 mM Tris–HCl pH 8.0, 50 mM NaCl, 7 mM β-mercaptoethanol) supplemented with a purified 3 nM TDP1. The reaction mixtures were incubated at a constant temperature of 24ºC in an EnSpire 2300 Multimode Plate Reader (PerkinElmer, Singapore) to measure fluorescence every 1 min (Ex485/Em520 nm). The relative TDP1 activity was measured at 7 min compared to that of DMSO control wells.