Log In Sign up
The largest database of trusted experimental protocols

Turbo dna free dnase

Manufactured by Promega
Visit Supplier

TURBO DNA-free™ DNase is a recombinant DNase I enzyme designed for rapid and efficient removal of DNA from RNA samples. The enzyme is highly active and heat-inactivated, allowing for easy removal of residual DNA without affecting the RNA.

Automatically generated - may contain errors

Lab products found in correlation

Superscript 4 vilo, by Thermo Fisher Scientific (2 mentions) Taqman mm00434256, by Thermo Fisher Scientific (2 mentions) Taqman mm01168134, by Thermo Fisher Scientific (2 mentions) Quantstudio 5 instrument, by Thermo Fisher Scientific (2 mentions) Reliaprep rna tissue miniprep system, by Promega (2 mentions)

Close spelling variants of this product

DNase (479 citations) DNA-free DNase (2 citations) TURBO DNase (2 citations)

2 protocols using turbo dna free dnase

1

Hepatic RNA Extraction and Quantification

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted from frozen livers using ReliaPrep™ RNA Tissue Miniprep System (Promega), according to the manufacturer’s instructions, as described63 (link), genomic DNA contamination was removed using Ambion® TURBO DNA-freeTM DNase. 1 μg of total RNA was reverse transcribed with Superscript IV Vilo (Life Technologies) prior to qPCR analysis for mouse il2 (TaqMan Mm00434256, Life Technologies), ifng (TaqMan Mm01168134, Life Technologies), HBV core (forward TACCGCCTCAGCTCTGTATC, reverse CTTCCAAATTAACACCCACCC, probe TCACCTCACCATACTGCACTCAGGCAA). Reactions were run and analysed on Quant Studio 5 instrument (Life Technologies). For viremia quantification, a standard curve was drawn using plasmid DNA. All experiments were performed in triplicate and normalized to the reference gene GAPDH.
Bénéchet A.P., De Simone G., Di Lucia P., Cilenti F., Barbiera G., Le Bert N., Fumagalli V., Lusito E., Moalli F., Bianchessi V., Andreata F., Zordan P., Bono E., Giustini L., Bonilla W.V., Bleriot C., Kunasegaran K., Gonzalez-Aseguinolaza G., Pinschewer D.D., Kennedy P.T., Naldini L., Kuka M., Ginhoux F., Cantore A., Bertoletti A., Ostuni R., Guidotti L.G, & Iannacone M. (2019). Dynamics and genomic landscape of CD8+ T cells undergoing hepatic priming. Nature, 574(7777), 200-205.
+ Open protocol
+ Expand
2

Hepatic RNA Extraction and Quantification

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted from frozen livers using ReliaPrep™ RNA Tissue Miniprep System (Promega), according to the manufacturer’s instructions, as described63 (link), genomic DNA contamination was removed using Ambion® TURBO DNA-freeTM DNase. 1 μg of total RNA was reverse transcribed with Superscript IV Vilo (Life Technologies) prior to qPCR analysis for mouse il2 (TaqMan Mm00434256, Life Technologies), ifng (TaqMan Mm01168134, Life Technologies), HBV core (forward TACCGCCTCAGCTCTGTATC, reverse CTTCCAAATTAACACCCACCC, probe TCACCTCACCATACTGCACTCAGGCAA). Reactions were run and analysed on Quant Studio 5 instrument (Life Technologies). For viremia quantification, a standard curve was drawn using plasmid DNA. All experiments were performed in triplicate and normalized to the reference gene GAPDH.
Bénéchet A.P., De Simone G., Di Lucia P., Cilenti F., Barbiera G., Le Bert N., Fumagalli V., Lusito E., Moalli F., Bianchessi V., Andreata F., Zordan P., Bono E., Giustini L., Bonilla W.V., Bleriot C., Kunasegaran K., Gonzalez-Aseguinolaza G., Pinschewer D.D., Kennedy P.T., Naldini L., Kuka M., Ginhoux F., Cantore A., Bertoletti A., Ostuni R., Guidotti L.G, & Iannacone M. (2019). Dynamics and genomic landscape of CD8+ T cells undergoing hepatic priming. Nature, 574(7777), 200-205.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!