Pcr barcoding kit

Total RNA was extracted from 12 samples which were divided into four groups (three replicate samples for each group).The NEBNext Poly(A) mRNA Magnetic Isolation Module was employed to enrich poly(A) mRNA to extract total RNAs from 12 root samples. We synthesize the cDNA for sequencing according to the strand-switching protocol from Oxford Nanopore Technologies. Firstly, full-length cDNA libraries were prepared from the poly(A) mRNAs by using the cDNA-PCR Sequencing kit by Oxford Nanopore (SQKPCS109) (Yao et al., 2020 (link)). Then, PCR was employed to amplify the cDNA for 13 to 14 cycles with specific barcoded adapters from the Oxford Nanopore PCR Barcoding kit (SQKPBK004). Finally, before loading onto a PromethION flow cell in a MinION sequencer, the 1D sequencing adapter was synthesized to the DNA. The sequencing was running on MinKNOW. The sequencing data were loaded to the Sequence ReadArchive (SRA), National Center for Biotechnology Information (NCBI), and the accession number is PRJNA717378.

The cleaned PCR products were quantified using a Qubit dsDNA kit (Thermo Fisher, Waltham, MA, USA) and were transformed into a sequencing library using a PCR Barcoding kit (Oxford Nanopore). This kit uses transposase which simultaneously cleaves template molecules in each sample and attaches tags, which contain primer binding sites, to the cleaved ends. Twelve primers were then used to amplify each sample: each primer contains a barcode and 5′ tag, which facilitates the ligase-free attachment of Rapid Sequencing Adapters. Amplified and barcoded samples were then pooled together, and Rapid Sequencing Adapters were added to the pooled mix. To obtain a high library yield sufficient for flow cell loading, the protocol was optimized for short fragments: the initial DNA input was doubled (200 ng per sample), and all steps involving DNA purification with magnetic beads were done in a reaction-to-beads ratio of 1:1, thereby avoiding a too-stringent size selection of short fragments. Then, each MinION flow cell (R9.4.1) was loaded with 12 pooled and indexed libraries, optimized to 200 fM of the library. The products were sequenced on an Mk1C system until the flow cell pores became inactive, the timing of which varied across different flow cells. Raw sequencing reads were deposited in the NCBI Sequence Read Archive (SRA) database under BioProject accession number PRJNA932161.

Poly(A) RNA-selected total RNAs were extracted by using the NEBNext Poly(A) mRNA Magnetic Isolation Module according to the manufacturer’s instructions. For ONT long-read RNA-seq, the cDNA was synthesized following the strand-switching protocol of Oxford Nanopore Technologies. Briefly, the cDNA-PCR Sequencing kit by Oxford Nanopore (SQK-PCS109) was used to prepare full-length cDNA libraries from the poly(A) mRNAs. Then the cDNA was amplified by PCR for 13–14 cycles with specific barcoded adapters from the Oxford Nanopore PCR Barcoding kit (SQKPBK004). Finally, the 1D sequencing adapter was ligated to the cDNA before being loaded onto a FLOPRO002 R9.4.1 flow cell in a PromethION sequencer. MinKNOW was used to run the sequencing. For the Illumina short-read RNA-seq, a TruSeq kit (Illumina) was used to treat 1 μg of poly(A)-selected total RNAs with DNase I for library preparation. Prepared RNA samples were sequenced on an Illumina HiSeq X Ten machine. The library construction and sequencing of ONT long-read RNA-seq and Illumina short-read RNA-seq were both performed by Wuhan Benagen Technology Co., Ltd. (Wuhan, China). The raw sequencing data were deposited in the Gene Expression Omnibus (GEO) database under the accession number of GSE209739.

The ONT library was constructed according to the PCR Barcoding Kit protocol (Oxford Nanopore, Cat. no. SQK-PBK004) using 200 ng amplification products. Sequencing was performed using a R9.4 flow cell on a MinION device (Oxford Nanopore) with the MinKNOW.

The step-by-step protocol for the construction of the sequencing library is available online at https://forgemia.inra.fr/guillem.rigaill/nanopore_chloro (accessed on 18 October 2021). Briefly, 10 fmoles of the RNA oligo /5Phos/rNrNrNrNrUrGrArArUrGrCrArArCrArCrUrUrCrUrGrUrArC/3InvdT/ (IDT Technologies, Leuven, Belgium) was ligated to the 3′ end of 100 ng of total RNA using 10 U of T4 RNA ligase 1 (NEB, Evry, France). Ligated RNA was depleted of rRNA using the QIAseq FastSelect -rRNA Plant Kit (QIAGEN, Les Ulis, France) before a full-length cDNA synthesis using the SMARTScribe™ Reverse Transcriptase (Takara, Saint Germain en Laye, France) and the oligos AAGCAGTGGTATCAACGCAGAGTACrGrG + G and AAGCAGTGGTATCAACGCAGAGTACGTACAGAAGTGTTGCATTC (IDT Technologies, Leuven, Belgium). Full-length cDNAs were amplified with the SeqAmp DNA Polymerase (Takara, Saint Germain en Laye, France) using the AAGCAGTGGTATCAACGCAGAGTAC primer and purified with AMPure XP beads (Beckman-Coulter, Villepinte, France). 35 fmoles of amplified cDNAs were converted to a nanopore sequencing library with the PCR barcoding kit (Oxford Nanopore Technologies, Oxford, UK) and then sequenced on an R10.3 MinIon flow-cell (Oxford Nanopore Technologies, Oxford, UK).