The Ts65Dn mice and their diploid littermates (2N) were genotyped using a real-time quantitative polymerase chain reaction (RT-qPCR) analysis77 (link). The tail or toe clippings were obtained from 10-day-old mouse pups and were stored at −20 °C till further processing. The genomic DNA was extracted from clippings using Wizard Genomic DNA Purification Kit per manufacturer’s instructions (Promega, Madison, WI, USA). The RT-qPCR was done using Brilliant SYBR Green Master Mix (Agilent, Santa Clara, CA, USA) in a Stratagene Mc3000p PCR detection system under the following conditions: 10 min at 95 °C, 40 cycles of denaturation at 95 °C for 30 s, annealing 55 °C for 1 min, extension at 72 °C for 1 min. The fold change in APP gene (3 copies in Ts65Dn mice) was evaluated. The apolipoprotein b (apob) gene (2 copies in Ts65Dn mice) was used as internal control. The primer sequences were the following: forward 5′-TGCTGAAGATGTGGGTTCGA-3′ and reverse 5′-GACAATCACGGTTGCTATGACAA-3′ for APP; forward 5′-CACGTGGGCTCCAGCATT-3′ and reverse 5′-TCACCAGTCATTTCTGCCTTTG-3′ for apob. The genotype was determined using ΔΔCT method by comparing ΔCT value of each unknown sample against a known calibrator average ΔCT77 (link).
Brilliant sybr green master mix
Manufactured by Agilent Technologies
Sourced in United States
Brilliant SYBR Green Master Mix is a ready-to-use solution for quantitative real-time PCR (qPCR) analysis. It contains SYBR Green I dye, DNA polymerase, dNTPs, and necessary buffers and reagents for amplification and detection of target DNA sequences.
Automatically generated - may contain errors
Lab products found in correlation
Wizard genomic dna purification kit, by Promega (1 mentions)
Revertaid h minus reverse transcriptase, by Thermo Fisher Scientific (1 mentions)
Oligo dt primer, by Eurofins (1 mentions)
Superscript 2 reverse transcriptase, by Thermo Fisher Scientific (1 mentions)
Lightcycler 480, by Roche (1 mentions)
Rna solv, by Omega Bio-Tek (1 mentions)
Rneasy kit, by Qiagen (1 mentions)
Trizol, by Thermo Fisher Scientific (1 mentions)
Superscript first strand kit, by Thermo Fisher Scientific (1 mentions)
Rneasy plus mini kit, by Qiagen (1 mentions)
Illustra rnaspin mini rna isolation kit, by GE Healthcare (1 mentions)
First strand cdna synthesis kit, by GE Healthcare (1 mentions)
6 protocols using brilliant sybr green master mix
1
Genotyping Ts65Dn and Diploid Mice
2
Quantitative Real-Time PCR Analysis of Viral Infection
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For quantitative real-time PCR (RT-qPCR), total RNA of infected cells, lung and liver homogenates was isolated as described previously50 (link). Equal amounts of RNA were transcribed into cDNA using Revert AID H Minus Reverse Transcriptase (MBI Fermentas, St. Leon-Rot, Germany) and oligo-(dT)-primers (Eurofins MWG Operon, Ebersberg, Germany) according to the manufacturer’s protocol. Samples were analysed by RT-qPCR on a Stratagene Cycler (Agilent Technologies, Santa Clara, USA) using gene-specific primers (Supplementary Table S6 ) and Brilliant SYBR Green Mastermix (Agilent, Waldbronn, Germany) according to the manufacturer’s instructions. To show reproducibility between experiments and obvious differences between mock-, single- and super-infected samples of IL-6 mRNA levels, raw Ct values of IL-6 in different cell lines are shown in Supplementary Table S7 . Additionally, PCR efficiency was calculated from cDNA of Calu-3 cells61 (link). Relative expression levels were compared with the reference gene Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) and calculated according to the 2−ΔΔCt method62 (link). The IV-infected samples were arbitrarily set as 100% and values of other samples were normalised to that value.
3
RNA Extraction and qRT-PCR Analysis of Calu-3 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For RNA isolation from Calu-3 cells approximately 5 × 105 cells were lysed using 500 μl of the RNA Solv® (Omega Bio-tek, Norcross, Georgia) and RNA was extracted following the manufacturer's protocol. Total RNA was reverse transcribed using oligo d(T) primers and SuperScript II Reverse Transcriptase (Thermo Fisher). qRT-PCR was performed using the Brilliant SYBR Green Mastermix (Agilent Technologies) in a LightCycler 480 (Roche, Basel, Swiss). Target gene expression was calculated using the 2−ΔΔCT method using GAPDH as housekeeping control gene (Livak and Schmittgen, 2001 (link)). Primer sequences are provided in Supplementary Table 1 .
4
Quantifying Thymic T Cell Subsets by qRT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For qRT–PCR, total RNA was prepared from 106 sorted thymic CD4+ SP (CD4+CD8−TCRγδ−CD25−CD1d–αGalCer tetramer−), large DP (CD71+FSChi) or small DP (CD71−FSClo) cells from Cul3cKO or Bcl6cKO, and their littermate controls by using TRIzol (Invitrogen), the RNeasy kit (QIAGEN), and reverse transcription with the Superscript III first strand synthesis super mix cDNA kit (Invitrogen). cDNA expression was determined with the Mx3005P using Brilliant SYBR green master mix (Agilent Technologies). Fluorescence signals were measured over 40 PCR cycles, and the cycle (Ct) at which signals crossed a threshold set within the logarithmic phase was recorded. The Ct for the target gene was subtracted from the Ct for 18S (ΔCt), and ΔΔCt was calculated by subtracting ΔCt for KO from ΔCt for littermate (ΔΔCt). The fold change of mRNA in KO over littermate was calculated as 2−ΔΔCt.
5
Cerebral Cortex Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The total RNA was extracted from a small piece of left cerebral cortex using RNeasy plus mini kit (Qiagen, Valencia, CA, USA) as per manufacturer’s instructions. Complementary DNA synthesis was performed by using SuperScript first strand kit (Invitrogen, Carlsbad, CA, USA). The RT-qPCR was carried out using Brilliant SYBR Green Master Mix (Agilent, Santa Clara, CA, USA) in a Stratagene Mc3000p PCR detection system employing the following conditions: 10 min at 95 °C, 40 cycles of denaturation at 95 °C for 30 s, annealing 55 °C for 1 min, extension at 72 °C for 1 min. The primer sequences were the following: forward 5′-CCGCCAGACAGGAAACACAT-3′ and reverse 5′-AACCCAGAGCACCAGGTTCA-3′ for the synaptophysin; forward 5′-GATGAGGACCAGAAGGTTGG-3′ and reverse 5′-GATTGGGTAGTTGGGCATTG-3′ for BDNF; forward 5′-GGTCCTCAGACTGGCCTACA-3′ and reverse 5′-GCTCCTGGTCCTGTCAACTC-3′ for BDNF receptor, tropomyosin receptor kinase B (TrkB); forward 5′- CTGATTCCCAAAAACGAAGG-3′ and reverse 5′-CTGCCCACTGCTAGTTTGGT-3′ for cAMP response element-binding protein (CREB); and forward 5′-AGGTCGGTGTGAACGGATTTG-3′ and reverse 5′-TGTAGACCATGTAGTTGAGGTCA-3′ for glyceraldehyde 3-phosphate dehydrogenase (GAPDH). Relative quantification was performed using the ΔΔCt method.
6
Quantitative Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from the MM cultured cells was isolated using the Illustra RNAspin Mini RNA Isolation Kit (GE Healthcare), according to the manufacturer's instructions. One microgram of total RNA were reverse transcripted using the First-Strand cDNA Synthesis Kit (GE Healthcare), as recommended by manufacturer protocol. Gene expression of HMG CoA, TGF β, VEGF, IL-6 and β FGF was quantified by qRT-PCR in a Stratagene MxPro 3005P thermocycler. The cDNAs were amplified in duplicate PCR reactions using the Brilliant SYBR® Green Master Mix (Agilent), 10 µM of each primer (HMG_f: 5' GACCATCTGCATGATGTCCA 3' HMG_r: 5' TTGACGTAAATTCTGGAACTGG 3'; TGF_f: 5' GAGCCTGAGGCCGACTACTA 3', TGF_r: 5' GGGTTCAGGTACCGCTTCTC 3'; VEGF_f: 5' CCTCCGAAACCATGAACTTT 3', VEGF_r: 5' GCAGTAGCTGCGCTGATAGA 3'; IL6_f: 5' CTCAGCCCTGAGAAAGGAGA 3', IL6_r: 5' TGATTTTCACCAGGCAAGTCT 3'; bFGF_f: 5' CAAAAACGGGGGCTTCTT 3', bFGF_r: 5' AGCCAGGTAACGGTTAGCAC 3´) and sufficient water to 25 µL. A negative control was also included for each gene amplification assay. The 18S rDNA (18S_f: 5' ATGCGTGCATTTATCA GA 3'; 18S_r: 5'AACTATCCCGTCTGCAAG 3') was used as an internal control. The PCR cycling conditions were: 10 min 95 °C; 40 cycles: 15 seg 95 °C, 30 seg 60 °C, 15 seg 72 °C; followed by a dissociation curve. Threshold cycle (Ct) was measured and a relative change in the expression level of one specific gene was presented as 2 -ΔΔCt .
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!