Herring testes dna ht dna

Sense (s) and antisense (as) 45-nt (s, 5′-TACAGATCTACTAGTGATCTATGACTGATCTGTACATGATCTACA-3′; as, 5′-TGTAGATCATGTACAGATCAGTCATAGATCACTAGTAGATCTGTA-3′)^{32 (link)} and 100-nt oligonucleotides (s, 5′-ACATCTAGTACATGTCTAGTCAGTATCTAGTGATTATCTAGACATACATCTAGTACATGTCTAGTCAGTATCTAGTGATTATCTAGACATGGACTCATCC-3′; as, 5′-GGATGAGTCCATGTCTAGATAATCACTAGATACTGACTAGACATGTACTAGATGTATGTCTAGATAATCACTAGATACTGACTAGACATG TACTAGATGT-3′)^{27 (link)} were purchased at 1 µmol scale from IDT and dissolved in 150 mM NaCl, 1 mM dithiothreitol (DTT), 20 mM Tris-HCl, pH 7.5, annealing buffer to obtain a 1-mM single-stranded DNA stock solution. The quality of oligonucleotides was verified by denaturing polyacrylamide gel electrophoresis. Annealing of s and as strands was conducted by incubating 200 µM each of s and as strand in annealing buffer at 95 °C for 90 s followed by slow cooling to 25 °C at a rate of 0.1 °C s⁻¹ in a Peltier thermocycler (BioRad). The completion of annealing was verified by native agarose gel electrophoresis^{32 (link)}. A modified pUT7 plasmid corresponding to 3200-bp DNA was isolated from transformed Escherichia coli Top10 with a PureLink HiPure Plasmid Megaprep Kit (Invitrogen). The plasmid was linearized with HindIII (NEB) and further purified by standard ethanol precipitation method and resuspended in MilliQ water. Herring testes DNA (HT-DNA) was purchased from Sigma (catalog number: D6898).

Transfection of siRNA, cGAMP, mtDNA, herring testis (HT), or plasmid DNA was performed using RNAiMax according to the maunfacturer's instructions (Invitrogen). mtDNA was isolated from mitochondria using the Mitochondrial Isolation Kit for Mammalian cells (Thermo Fisher Scientific) and mtDNA was purified by QIAamp® DNA Mini Kit. Mouse mtDNA was prepared from PolgA^+/+ MEFs and human mtDNA was prepared from primary human skin fibroblasts. Herring Testes DNA (HT‐DNA) was purchased from Sigma‐Aldrich (D6898).
Mouse mtDNA, human mtDNA, or mtDNA that had been digested by 20 μg/ml DNase I (Sigma‐Aldrich) for 30 min at 37°C as DNase I‐pretreated mtDNA, were transfected with RNAiMax for 48 h. 4 μg/ml cGAMP (Sigma‐Aldrich, 5.31889.0001) was transfected with RNAiMax for 24 h. Mouse mtDNA was transfected at a concentration of 100 ng/ml into MEFs or pmAT2. Human mtDNA was used at a concentration of 200 ng/ml for phLF transfection. siRNAs were transfected for 48 h at a final concentration of 5 nM. Details on the siRNAs applied in this study are provided in Table EV4. HT‐DNA or plasmid DNA was transfected at a concentration of 1 μg/ml.