Superscript 2 reverse transcription system

Total RNA was isolated from HBEpCs using TRIzol^® (Invitrogen Life Technologies, Beijing, China), according to the manufacturer’s instructions. cDNA was synthesized from the RNA using the Superscript II Reverse Transcription system (Invitrogen Life Technologies). qPCR was performed using a SYBR Green PCR kit (Takara Biotechnology Co. Ltd., Dalian, China) using an iCycler (ABI ViiATM7; Applied Biosystems, Carlsbad, CA, USA). The thermocycler parameters were set as follows: Step one, activation of the HotStartTaq DNA polymerase (Takara Biotechnology Co. Ltd.) at 95°C/30 sec; step two, PCR was performed for 40 cycles, denaturation at 95°C/5 sec, annealing at 60°C/34 sec; step three, fixed parameters set by the ABI ViiA 7 Fast Real-time PCR system (Applied Biosystems). GAPDH was used as an internal standard. The primer sequences were designed using the NCBI-Primer Basic Local Alignment Search Tool (National Institutes of Health, Bethesda, MD, USA) online tool and synthesized by Sangon Biotech, Shanghai, Co., Ltd. (Shanghai, China). The oligonucleotides used were as follows: SIRT1 forward, 5′-ATTCCAGCCATCTCTCTGTCAC-3′, and reverse, 5′-GTCTTGTATCTGTGCGACCTTG-3′; ORP150 forward, 5′-CAGAGGGAGAGAAGAAGCAGAA-3′, and reverse 5′-CAAGACCTGGACGGACTGAA-3′; GAPDH forward, 5′-AGAAGGCTGGGGCTCATTTG-3′, and reverse, 5′-AGGGGCCATCCACAGTCTTC-3′.

RNA was isolated using an RNeasy kit (Qiagen) and treated with 1 unit of amplification grade DNase I (Invitrogen) per 1 μg RNA at room temperature for 15 min to remove genomic DNA followed by inactivation of the DNase I with 2.5 mM EDTA (pH 8.0) and incubation at 65°C for 5 min. Reverse transcription was done with 2 μg total RNA using SuperScript II reverse transcription system (Invitrogen) according to the manufacturer's instructions. For RT-PCR analysis, an initial amplification was done with a denaturation step at 95°C for 3 min, followed by denaturation at 95°C for 30 seconds, primer annealing at 58°C for 30 seconds, and primer extension at 72°C for 30 seconds. The primer sequences are provided in Supplementary Table 1. Upon completion of the cycling steps, a final extension was performed at 72°C for 7 min. Quantitative real-time PCR analysis was conducted using a GoTaq® qPCR mixture (Promega). Reactions were run in triplicate for three independent experiments. The mean of housekeeping gene GAPDH was used as an internal control to normalize the variability in expression levels. The primer sequences for real-time PCR analysis are provided in Supplementary Table 2. Expression data were normalized to the mean of GAPDH to control the variability in expression levels and were analyzed using the 2^−ΔΔCT method.

RNA was isolated using an RNeasy kit (Qiagen) and treated with 1 unit of amplification grade DNase I (Invitrogen) per 1 µg RNA at room temperature for 15 minutes to remove genomic DNA followed by the inactivation of the DNase I with 2.5 mmol/L EDTA (pH 8.0) and incubation at 65°C for 5 minutes. Reverse transcription was performed with 2 µg total RNA using the SuperScript II reverse transcription system (Invitrogen) according to the manufacturer's instructions. Quantitative real‐time PCR analysis was conducted using a GoTaq® qPCR mixture (Promega). The primer pairs used in this study include: p16 (5′‐GAACTCTTTCGGTCGTACCC‐3′ and 5′‐CGAATCTGCACCGTAGTTGA‐3′), p21 (5′‐TTGTCGCTGTCTTGCACTCT‐3′ and 5′‐TTTCGGCCCTGAGATGTTCC‐3′), IL6 (5′‐TTGGGACTGATGCTGGTGAC‐3′ and 5′‐ CTGTGAAGTCTCCTCTCCGG‐3′), and GAPDH (5′‐GGACCTCATGGCCTACATGG‐3′ and 5′‐TAGGGCCTCTCTTGCTCAGT‐3′). Amplification and detection of specific mRNAs were performed using Eppendorf RealPlex². Reactions were run in triplicate for three independent experiments. The mean of housekeeping gene GAPDH was used as an internal control to normalize the variability in expression levels. Expression data were normalized to the mean of GAPDH to control the variability in expression levels and were analyzed using the 2^−ΔΔCT method.

Gene expression and mtDNA levels were determined by Taqman real time PCR as previously described 48. Briefly, one microgram of RNA was transcribed into complementary DNA by SuperScript® II reverse transcription system (Invitrogen). Complementary DNA (0.1–0.2 ml) and 100 ng DNA were used to measure gene expression and mitochondrial DNA levels, respectively. TaqMan real‐time PCR was performed using the TaqMan Universal PCR master mix and the standardized primers for mouse PGC‐1α (Mm00447183), NRF‐1 (Mm00447996), NRF2 (Mm00477786), TFAM (Mm00447485), RIP140 (Mm01343436), GPX1 (Mm00656767), Catalase (Mm00437992), SOD1 (Mm01700393), SOD2 (Mm00449726), DRP1 (Mm01342903), Fis1 (Mm00481580), OPA1 (Mm00453879), MFN1 (00612599) and MFN2 (00500120). To quantify DNA content, mouse cytb probe was used (Custom TaqMan Gene Expression Assays; Applied Biosystems). Quantification of mitochondrial DNA was referred to nuclear DNA as determined by the amplification of the intronless nuclear gene CEBP (Mm00514283). Expression of the genes of interest was normalized to that of the reference control mouse RPLP0 (Mm01974474).