Nucleospin rna 2 column

Total RNAs from cells were purified by a NucleoSpin RNA II column (740955; Clontech) according to manufacturer’s instruction. cDNAs were synthesized from the total RNAs using an iScript cDNA synthesis kit (1708891; Bio-Rad). qRT–PCR was performed and analyzed using a Bio-Rad CFX Connect real-time system. Relative expression was determined by ΔΔCt calculation and normalized to GAPDH mRNA levels of the same sample. The qRT–PCR primer sequences used for respective target transcripts are as follows: GAPDH, Forward: GTCTCCTCTGACTTCAACAGCG, Reverse: ACCACCCTGTTGCTGTAGCCAA; TLR-4, Forward: CCTGAGCTTTAATCCCCTGAGGC, Reverse: CAGAAAAGGCTCCCAGGGCTA; BCL2, Forward: ATCGCCCTGTGGATGACTGAGT, Reverse: GCCAGGAGAAATCAAACAGAGGC; BCL2A1, Forward: GGATAAGGCAAAACGGAGGCTG, Reverse: CAGTATTGCTTCAGGAGAGATAGC; cIAP2, Forward: GCTTTTGCTGTGATGGTGGACTC, Reverse: CTTGACGGATGAACTCCTGTCC; IL-8, Forward: GAGAGTGATTGAGAGTGGACCAC, Reverse: CACAACCCTCTGCACCCAGTTT; IL-10, Forward: TCTCCGAGATGCCTTCAGCAGA, Reverse: TCAGACAAGGCTTGGCAACCCA; NFKB1, Forward: GCAGCACTACTTCTTGACCACC, Reverse: TCTGCTCCTGAGCATTGACGTC; and NFKBIA, Forward: TCCACTCCATCCTGAAGGCTAC, Reverse: CAAGGACACCAAAAGCTCCACG.

Total RNAs from treated cells were purified by a Nucleospin RNA II column (740955, Clontech) according to the manufacturer’s instruction. cDNAs were synthesized from the total RNAs using iScript cDNA synthesis kit (1708891, Bio-Rad). qRT-PCR was performed and analyzed using a Bio-Rad CFX Connect real-time system. Relative expression was determined by ΔΔCt calculation. The mRNA levels of the samples were normalized to GAPDH mRNA levels and shown as fold induction relative to GST-treated control samples. The primers for qRT-PCR analysis are: IL-8 (forward, 5’-tgcagctctgtgtgaagg-3’; reverse, 5’-ctcagccctcttcaaaaac-3’), IL-10 (forward, 5’-aggatcagctggacaacttg-3’; reverse, 5’-gatgtctgggtcttggttctc-3’), BCL2A1 (forward, 5’-tacaggctggctcaggactat-3’; reverse, 5’-cgcaacattttgtagcactctg-3’), Bcl-2 (forward, 5’-ggtggggtcatgtgtgtgg-3’; reverse, 5’-cggttcaggtactcagtcatcc-3’), and Bcl-XL (forward, 5’-gagctggtggttgactttctc-3’; reverse, 5’-tccatctccgattcagtccct-3’).