Qrt pcr

The tissue samples used here were the same as those obtained for the WB studies described above. Total RNA was extracted from brain tissue and reverse-transcribed into complementary DNA. Next, relative mRNA expression of genes was normalized to that of beta-tubulin, and the fold change was evaluated using the 2−ΔΔCT method. The primer sequences used for quantitative Real-Time PCR (qRT-PCR) were obtained from RiboBio (Guangzhou, China) and were as follows: CLCF1 forward 5′-CTTAGCTGGGACCTACCTGAA-3′, reverse 5′-CCACACTTCCAAGTTGACCGT-3′; and Tubulin beta forward 5′-GGCCAAGGGTCACTACACG-3′, reverse 5′-GCAGTCGCAGTTTTCACACTC-3′.

Total RNA was extracted from cardiac tissues or cardiomyocytes. The Trizol RNAiso Plus kit (TaKaRa, 9109) was used for RNA extraction, and the RevertAid First Strand cDNA Synthesis Kit (Thermo Fisher Scientific, K1622) was used for reverse transcription (RT). The quantitative PCR was then performed using the following primers (5′-3′): rno-ANP-F: GAGCAAATCCCGTATACAGTGC; rno-ANP-R: ATCTTCTACCGGCATCTTCTCC; rno-BNP-F: CTGCTTGCGGAGGCGAGAC; rno-BNP-R: TGTTCTGGAGACTGGCTAGGACTTC; hsa-CDK10-F: GCCTGCGTCATCCGAACAT; hsa-CDK10-R: AGGGTGTTGGCATATTCTCCA; hsa-EFNA3-F: CATGCGGTGTACTGGAACAG; hsa-EFNA3-R: AGATAGTCGTTCACGTTCACCT. The miR-210 expression in heart tissues or cardiomyocytes was determined by qRT-PCR (RiboBio, Guangzhou, China). 18S or 5S was used for internal control as appropriate. For analysis of circulating miR-210 levels, total RNA was extracted from serum samples using MirVana miRNA isolation kit (Thermo Fisher Scientific, AM1561). Caenorhabditis elegans miR-39 (cel-miR-39) was spiked in to normalize the blood volume. The primers for miRNA detection in the blood sample by PCR were obtained from RiboBio (Guangzhou, China).

Total RNA from RAW264.7 and THP-1 cells were extracted with TRIzol reagent (Invitrogen, USA). Total miRNA was extracted from tissues and cells and quantified using the miRNeasy Serum/Plasma Kit (QIAGEN, Germany). cDNA was synthesized from the total RNA (1000 ng) using RevertAid first-strand cDNA (Fermentas; Thermo Fisher Scientific, Inc.) or a TaqMan microRNA reverse transcription kit (Applied Biosystems; Thermo Fisher Scientific, Inc.). All reactions were performed in triplicate using a SYBR Green PCR kit (Qiagen, USA) according to the manufacturer's instructions. The primer sequences used for qRT-PCR (RiboBio) are listed in Table 1. All statistical analyses were normalized to the internal controls U6, GAPDH, andβ-actin.