Total RNAs were extracted from liver tissues using Ribospin II extraction kit (GeneAll Biotechnology, Seoul, Korea) following the manufacturer's protocol without modification. One microgram of the RNA was used to synthesize complementary DNAs using a ReverTra Ace® qPCR RT Master Mix reagent and a T100TM Bio‐Rad Thermal Cycler (Hercules, CA, USA) at 37℃ for 15 min, according to the manufacturer's instructions. PCR was performed using a SYBR Premix Ex TaqTM (Takara, Shiga, Japan) and a Light Cycler (Takara). The reaction mixture for the PCR assay consisted of 0.0125 ml of TB Green Premix Ex Taq; 0.002 ml of forward and reverse primers for GAPDH (F: ggctacactgaggaccaggtsequences; R: tccaccaccctgttgctgta), COX‐2 (F: atactggaagccgagcacct; R: gtgggaggcacttgcattga), IL‐17 (F: tgtcaatgcggagggaaagc; R: ccacacccaccagcatcttc), and iNOS (F: cggagtgacggcaaacatga; R: ttccagcctaggtcgatgca); 0.002 ml of cDNA; and 0.0085 ml of distilled water. The thermal profile of the assay was as follows: 95℃ for 5 min, 40 cycles of 95℃ for 30 s and 62℃ for 30 s. All samples were run in triplicate, and the fluorescence data of target genes were analyzed with the 2−ΔΔCt method for relative quantification using GAPDH as an internal control.
Ribospin 2 extraction kit
Manufactured by GeneAll
The Ribospin II extraction kit is a laboratory equipment product designed for the extraction and purification of RNA from various biological samples. It is a tool used in molecular biology and genomics research applications.
Automatically generated - may contain errors
Lab products found in correlation
T100 thermal cycler, by Bio-Rad (2 mentions)
Lightcycler, by Takara Bio (1 mentions)
Sybr premix ex taqtm, by Takara Bio (1 mentions)
Nanodrop spectrophotometer, by Thermo Fisher Scientific (1 mentions)
Primescript rt master mix, by Takara Bio (1 mentions)
Sybr premix ex taq, by Takara Bio (1 mentions)
Stratagene mx3000p, by Agilent Technologies (1 mentions)
3 protocols using ribospin 2 extraction kit
1
Liver RNA Extraction and qPCR Analysis
2
Gene Expression Analysis After CCI
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Forty-eight hours after CCI, slices were collected, and total RNA was extracted by using the Ribospin II extraction kit (GeneAll) following the manufacturer’s protocol. The RNA concentration was determined with a Nanodrop spectrophotometer and 200 ng/μl RNA from each sample was reverse transcribed to cDNA using TaqMan® qPCR RT Master Mix (Applied Biosystems by life technologies) following the manufacturer’s protocol. Real-time RT-PCR was performed, and the relative gene expression to the reference gene RPL27 was determined by ΔΔCt method. Data are expressed as log2 of the fold difference from the CTRL group. The primers used are listed in Table 1 . Primers were designed using the Primer-BLAST tool (NCBI, United States),1 and Prime3 open-source software.2
3
Quantitative Analysis of Cytokine Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted and purified from excised dorsal skin using the Ribospin II Extraction Kit (GeneAll Biotechnology, Korea). The extraction was done following the manufacturer's specifications and the RNA extracted was stored at -20°C. The RNA (1 μg) was reverse transcribed to cDNA using a PrimeScript RT Master Mix (Takara Bio Inc, Japan) following the manufacturer's protocol with a T100TM Bio-Rad Thermal Cycler set at 42°C for 1 h. cDNA was amplified with Stratagene Mx3000P (Agilent Technologies Inc., USA) using the SYBR Premix Ex Taq (Takara Bio Inc., Japan) following the manufacturer's procedure. The standard cycle settings were: 95°C for 5 min, 40× (95°C for 30 sec, 62°C for 30 sec) followed by a dissociation curve ramping from 95°C to 55°C and back to 95°C. The following primers were used: sense, 5'-CCT ACC CTG GTG CTG CTT TG-3' and antisense, 5'-CTG ACA TCC CAG ATG CCT GC-3' for IL-31 ; sense, 5'-CCA GGA GCC ATA TCC ACG GA-3' and antisense, 5'-CTG TGA GGA CGT TTG GCA CA-3' for IL-4 ; sense, 5'-GGC TAC ACT GAG GAC CAG GT-3' and antisense, 5'-TCC ACC ACC CTG TTG CTGTA-3' for glyceraldehyde 3-phosphate dehydrogenase (GAPDH). All samples were run in triplicate and fluorescence data of target genes were analyzed for relative quantification using GAPDH as a control.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!