Chemidoc software image lab 4

For quantitative amplification of mRNA, we used 1 μg of total RNA and iScript™ Reverse Transcription Supermix (cat # 1708841, Bio-Rad Laboratories, USA) to synthesize cDNA, which was then amplified using SYBR green in a C1000 Touch thermal cycler (Bio-Rad Laboratories, USA) following manufacturer’s instructions^{19 (link)}. We used 18sRNA as an endogenous control. The primer sequences were: ANP (NM_008725), forward 5′CTGCCTCATTAATGCTTAC3′, reverse 5′TGGCTGTTATCTTCGGTAC3′, 18sRNA (NR_003278), forward 5′GTAGTTCCGACCATAAACGA3′ and reverse 5′TCAATCTGTCAATCCTGTCC3′, CSE (AY262829), forward 5′TGCCTCACCCCATTTCATCT3′ and reverse 5′GAGTAAACTGGGTGAGGGCT3′, and CBS (NM_144855) forward 5′TGCGGAACTACATGTCCAAG3′ and reverse- 5′TTGCAGACTTCGTCTGATGG3′. The melting temperature for all reactions was 55 °C. For qualitative PCR of CSE, cDNA was amplified in a BioRad cycler, and electrophoresis was performed in a 2% agarose gel. The gel was developed by a Chemidoc (Bio-Rad Laboratories, USA), and band intensity was quantified by a Chemidoc software Image Lab 4.1 (Bio-Rad Laboratories, USA).

Standard protocol for Western blotting was used^{19 (link)}. Protein was extracted from HL1 cardiomyocytes and heart tissue by using radio-immuno-precipitation assay lysis buffer (RIPA, cat # BP-115D, Boston BioProducts, USA), and quantified by using BCA protein assay kit (cat # 23227, Pierce, USA). Equal amounts (30 µg) of proteins were used for SDS-PAGE. The primary antibodies used were: β-MHC (cat # ab172967, Abcam, USA), ANP (cat # GTX 109255, Gentex, USA), CBS (cat # H00000875-M01, Abnova, USA), CTH (cat # H00001491-M02, Abnova, USA), β-actin (cat # sc-47778, Santa Cruz Biotechnology, USA), β-tubulin (cat # MA5-16308, Thermo Scientific Inc., USA), p-SP1 (cat # ab59257, Abcam, USA), and SP1 (cat # 07-645, Millipore, USA). The secondary antibodies used were: anti-mouse IgG-HRP, and anti-rabbit IgG-HRP (cat # sc-2005, and cat # sc-2054, respectively, Santa Cruz Biotechnology, USA). Restore™ PLUS Western Blot stripping buffer (cat # 46430, Thermo Scientific Inc., USA) was used for restriping and reprobing of blots. Western blot membrane was developed by a Clarity™ Western ECL Substrate (cat # 1705061, Bio-Rad Laboratories, USA), imaged by a Chemidoc (Bio-Rad Laboratories, USA), and band intensity was analyzed by a Chemidoc software Image Lab 4.1 (Bio-Rad Laboratories, USA).

For immunoblotting, the WT_HmsE-Flag and ΔcsrA_HmsE-Flag strains were cultured in TMH-gal medium, and cells were harvested during the exponential growth phase. Cells were suspended and boiled in 1× Laemmli sample buffer for 5 min. Lysates were separated by SDS page and transferred to a 0.2- μm nitrocellulose membrane (Bio-Rad). HmsE-Flag protein was detected using monoclonal anti-FLAG M2 (Sigma) antibodies (1:20,000), affinity purified horseradish peroxidase (HRP)-labeled goat anti-mouse (KPL) antibodies (1:10,000), and the SuperSignal West Femto substrate (Thermo Scientific). The No-Stain protein labeling reagent (Invitrogen) was used to normalize total protein loaded per lane of the gel. The HmsE-Flag protein was quantified by densitometry using the ChemiDoc software Image Lab 4.1 (Bio-Rad).