Gold(iii ) chloride aflatoxin B1 (Afl B1), and ochratoxin were purchased from Sigma-Aldrich. Sodium citrate and sodium chloride were procured from Sisco Research Laboratories Pvt. Ltd. (SRL), India. The aptamer sequence of Afl B1 was GTTGGGCACGTGTTGTCTCTCTGTGTCTCGTGCCCTTCGCTAGGCCCACA (5′ to 3′). The ssDNA oligonucleotides were synthesized by GCC biotech. Stock solutions (100 μM) of aptamers were dissolved in ultrapure water and stored at −20 °C. Whatman filter paper was purchased from GE healthcare, India. Trysulfonium hexaflurophosphate and propylene glycol monomethyl ether acetate (PGMEA) were procured from Sigma-Aldrich. All reagents were of analytical grade and used as received.
Trysulfonium hexaflurophosphate
Manufactured by Merck Group
Trysulfonium hexaflurophosphate is a chemical compound used in various laboratory applications. It serves as a reagent and is known for its ability to facilitate specific chemical reactions. The core function of this product is to provide a controlled and efficient means of carrying out targeted experiments in a laboratory setting.
Automatically generated - may contain errors
Lab products found in correlation
Whatman filter paper, by GE Healthcare (2 mentions)
Sodium citrate, by Sisco Research Laboratories (2 mentions)
Sodium chloride (nacl), by Sisco Research Laboratories (2 mentions)
Propylene glycol monomethyl ether acetate, by Merck Group (1 mentions)
Ochratoxin, by Merck Group (1 mentions)
Gold 3 chloride, by Merck Group (1 mentions)
Propyleneglycol monomethylether acetate pgmea, by Merck Group (1 mentions)
2 protocols using trysulfonium hexaflurophosphate
1
Aptamer-based Aflatoxin B1 Detection
2
Aptamer-based Detection of Mycotoxins
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Gold (III) chloride and Aflatoxin M1 (Afl M1) were purchased from Sigma-Aldrich. Sodium citrate and sodium chloride were procured from Sisco Research Laboratories Pvt. Ltd. (SRL), India. The 21-mer aptamer sequence of Afl M1 (ACTGCTAGAGATTTTCCACAT (5′ to 3′)), The Ochratoxin aptamer sequence used was 36-mer 5-GATCGGGTGTGGGTGGCGTAAAGGGAGCATCGGACA-3 and the ssDNA oligonucleotides were synthesized by GCC biotech, India. Stock solutions (100 μM) of aptamers were dissolved in ultrapure water then stored at −20 °C. Whatman filter paper was purchased from GE healthcare, India. Trysulfonium hexaflurophosphate and Propylene glycol monomethyl ether acetate (PGMEA) were procured from Sigma-Aldrich. All reagents were of analytical grade and used as received.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!