Mammalian total rna miniprep kit

Manufactured by Merck Group

Sourced in United States

The Mammalian Total RNA Miniprep Kit is a laboratory product designed to extract and purify total RNA from mammalian cells or tissues. It utilizes a rapid and efficient spin-column-based method to isolate high-quality RNA suitable for various downstream applications such as RT-PCR, northern blotting, and microarray analysis.

Automatically generated - may contain errors

Lab products found in correlation

Trizol, by Thermo Fisher Scientific (2 mentions) Random hexamer, by Thermo Fisher Scientific (2 mentions) Iscript select cdna synthesis kit, by Bio-Rad (2 mentions) Dig rna labeling kit, by Roche (2 mentions) Zymosan, by Merck Group (1 mentions) Liberase, by Merck Group (1 mentions) Dnase 1, by Merck Group (1 mentions) Polymyxin b, by Merck Group (1 mentions) Quantstudio 5 platform, by Thermo Fisher Scientific (1 mentions) Verso cdna synthesis kit, by Thermo Fisher Scientific (1 mentions) Cfx connect real time system, by Bio-Rad (1 mentions) Quantstudio 7 flex real time pcr system, by Thermo Fisher Scientific (1 mentions) C1000 thermal cycler system, by Bio-Rad (1 mentions) High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (1 mentions) Sybr green qpcr kit, by Takara Bio (1 mentions) Ab 7500 fast system, by Thermo Fisher Scientific (1 mentions) Geneamp pcr system 9700, by Thermo Fisher Scientific (1 mentions) M mlv reverse transcriptase, by Promega (1 mentions) Dntps, by Promega (1 mentions)

10 protocols using mammalian total rna miniprep kit

Immune Cell Stimulation Protocols

Check if the same lab product or an alternative is used in the 5 most similar protocols

For cell stimulation experiments, FL-DCs (1 × 10⁶/well) were incubated in the presence of poly (I:C) (50 µM, InvivoGen, San Diego, CA, USA) or zymosan (100
µg/ml, MilliporeSigma) at 37°C for 24 h. Then, cells were analyzed by flow cytometry for specific cell activation markers.
For stimulation of spleen cells, spleens were cut and incubated with a mixture of 2 U/ml LiberaseTM (MilliporeSigma) and 20 U/ml DNaseI (MilliporeSigma) in RPMI1640 medium containing 10%
FCS, 1% β-mercaptoethanol, 100 U/ml penicillin, and 100 µg/ml streptomycin, for 30 min at 37°C water bath with shaking. Then, the suspension was passed through sterile gauze
and 5 × 10⁵ cells in 200 µl were seeded in a 96-well plate. Indicated concentrations of LPS, PTX or M. tuberculosis were added in 10
µl of PBS. Polymyxin B (10 µg/ml) (MilliporeSigma) was added to all wells to exclude the influence of LPS in PTX or M. tuberculosissamples. After 16 h incubations cells were collected, and RNA was isolated using Mammalian Total RNA Miniprep kit (MilliporeSigma) with further RT-qPCR analysis.

Makusheva Y., Chung S.H., Akitsu A., Maeda N., Maruhashi T., Ye X.Q., Kaifu T., Saijo S., Sun H., Han W., Tang C, & Iwakura Y. (2022). The C-type lectin receptor Clec1A plays an important role in the development of experimental autoimmune encephalomyelitis by enhancing antigen presenting ability of dendritic cells and inducing inflammatory cytokine IL-17. Experimental Animals, 71(3), 288-304.

+ Open protocol

+ Expand

EAE-induced Transcriptomic Changes in Draining Lymph Nodes

Check if the same lab product or an alternative is used in the 5 most similar protocols

Inguinal draining LNs (dLNs) from WT and Clec1a^−/−mice (n=5 in each group) were collected in a steady-state and at day 10 and 16 after EAE induction. Total RNA
was extracted using Mammalian Total RNA Miniprep kit (MilliporeSigma, Burlington, MA, USA) and RNAs from each group were pooled with equal amounts. Total RNA sequencing was conducted by
Rhelixa Japan. RNA-Seq library was constructed, followed by next-generation sequencing on Illumina platform with total raw reads at 40 million per sample. The raw sequencing data were
processed using Galaxy platform. The reads were trimmed by Trimmomatic, and then aligned by HISAT2 referred to genome GRCm38 (mm10). Data were transformed to log2 (TPM+1) for further
analysis. Genes with fold change >1 or <1 were considered as upregulated and downregulated genes, respectively. Upregulated and downregulated genes were used for KEGG pathway analysis.
Heatmaps were normalized by row and plotted using pheatmap R package and GraphPad Prism software. RNA-Seq raw and processed data were deposited in GEO repository with the accession number
GSE190289.

+ Open protocol

+ Expand

Quantitative Real-Time PCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated from colonic tissues using the Mammalian Total RNA Miniprep Kit (Cat# AG11706, Sigma-Aldrich, St. Louis, MO, USA). Reverse transcription of RNA to cDNA was performed with the Evo M-MLV RT Master Mix (Agbio, Hunan, China) according to the manufacturer’s instructions. Quantitative real-time PCR (qRT-PCR) was then conducted using the SYBR Green Premix Pro Taq HS qPCR Kit (Cat# AG11718, Agbio) on a QuantStudio5 platform (Thermo Fisher Scientific, Waltham, MA, USA). Primer sequences used for qRT-PCR are listed in Supplementary Table S1. Gene expression levels were normalized to Gapdh.

Qiu D., Xu S., Ji K, & Tang C. (2024). Myeloid Cell-Derived IL-1 Signaling Damps Neuregulin-1 from Fibroblasts to Suppress Colitis-Induced Early Repair of the Intestinal Epithelium. International Journal of Molecular Sciences, 25(8), 4469.

+ Open protocol

+ Expand

RNA Extraction and RT-qPCR from Liver Tissue

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA extraction was done with TRIzol (15596018; Thermo Fisher) and Sigma-Aldrich GenElute Mammalian Total RNA Miniprep Kit per protocol (RTN70-1KT) on liver tissue. Complementary DNA was generated from 1 ng of isolated RNA via Verso cDNA Synthesis Kit (AB1453B; Thermo Fisher). All primer sequences were validated for each transcript (Table S1) and ordered through Integrated DNA Technologies. Triplicates of RT-qPCR were performed via the Bio-Rad CFX Connect Real-Time System. Beta-actin was used for the internal control and relative mRNA levels were obtained via comparative threshold cycle method.

Song E., Nagarapu A., van Nispen J., Armstrong A., Manithody C., Murali V., Voigt M., Samaddar A., Hutchinson C., Jain S., Roenker J., Krebs J, & Jain A.K. (2022). Carbamazepine Mitigates Total Parenteral Nutrition Associated Liver Disease in a Novel Ambulatory Piglet Model. JPEN. Journal of parenteral and enteral nutrition, 46(6), 1384-1392.

+ Open protocol

+ Expand

Quantifying Gene Expression in BMDMs

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA from BMDMs were extracted with Mammalian Total RNA Miniprep Kit (Sigma, USA) according to the manufacturer’s protocols. Real-time quantitative polymerase chain reaction (qPCR) was performed using the Quant Studio 7 Flex Real-Time PCR System (Applied Biosystems, USA). Relative gene expressions were normalized with glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and analyzed by 2^−ΔΔCT method. The gene primers sequences were synthesized by Eurofins Genomics (Louisville, USA) and listed in Supplementary Table 1.

Yang Q.B., Zhang M.Y., Yang L., Wang J., Mi Q.S, & Zhou J.G. (2024). Deficiency of histone deacetylases 3 in macrophage alleviates monosodium urate crystals-induced gouty inflammation in mice. Arthritis Research & Therapy, 26, 96.

+ Open protocol

+ Expand

Mammalian Total RNA Extraction and qPCR

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from BMDMs using a Mammalian Total RNA Miniprep Kit (Sigma). Q-PCR data collected on the QuantStudio 7 were normalized to the β-actin gene in the corresponding sample. Primer sequences are listed in Table S1 in Supplementary Material.

Wang J., Yang Q., Zhang Q., Yin C., Zhou L., Zhou J., Wang Y, & Mi Q.S. (2017). Invariant Natural Killer T Cells Ameliorate Monosodium Urate Crystal-Induced Gouty Inflammation in Mice. Frontiers in Immunology, 8, 1710.

+ Open protocol

+ Expand

Quantitative RT-PCR Analysis of Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted with a Mammalian Total RNA Miniprep kit (Cat# RTN350-1KT, Sigma Aldrich). RNA was denatured in the presence of an oligo dT primer and then reverse transcribed with a High Capacity cDNA Reverse Transcription kit (Cat# 4368814, Applied Biosystems, San Francisco, U.S.A.). qPCR was performed with a SYBR Green qPCR kit (Cat# 639676, Takara Bio., Shika, Japan) and C1000 Thermal Cycler system (Bio-Rad, Hercules, USA) with the sets of primers described in Supplementary Table 2, and relative mRNA expression levels were calculated with the comparative cycle threshold (Ct value) method and were normalized with Gapdh mRNA expression level.

Tang C., Sun H., Kadoki M., Han W., Ye X., Makusheva Y., Deng J., Feng B., Qiu D., Tan Y., Wang X., Guo Z., Huang C., Peng S., Chen M., Adachi Y., Ohno N., Trombetta S, & Iwakura Y. (2023). Blocking Dectin-1 prevents colorectal tumorigenesis by suppressing prostaglandin E2 production in myeloid-derived suppressor cells and enhancing IL-22 binding protein expression. Nature Communications, 14, 1493.

+ Open protocol

+ Expand

Quantifying Gene Expression by qPCR

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA extraction was performed using the Mammalian Total RNA Miniprep kit (Sigma) according to the manufacturer's protocol and quantified using the NanoDrop system. A total of 1 μg of RNA was reversetranscribed using 0.5 μg random hexamers (Thermo Scientific), 0.5 mM dNTPs (Promega, Wisconsin, United States) and 200 U M-MLV reverse transcriptase (Promega) using the GeneAmp PCR System 9700 (Applied Biosystems, Thermo Fisher Scientific, Massachusetts, United States). Gene expression changes were determined by SYBR Green qPCR using the AB7500 Fast system (Applied Biosystems). Primers sequences used were as follows: Tensin 3 (F) GTTGAAAGGGTGCTCGAATGA, Tensin 3 (R) GAACTTTCTGCTATTTCCTCCAATG (Cao et al. 2012) , HPRT (F) AAATTCTTTGCTGACCTGCT, HPRT (R) TCCCCTGTTGACTGGTCATT, Cten (F) GCGTCTGCTCAGAATCGAC and Cten (R) GATGAGGAAGTGTCGGATGAG. The run cycle comprised a hold stage at 95°C for 2 min, cycling stage 40X (95°C for 3 s, annealing temperature for 30 s) and a melt curve stage 95°C for 15 s, 50°C for 1 min, 95°C for 15 s, 95°C for 15 s and 50°C for 15 s. Reactions were determined as having similar efficiencies, and the ΔΔCt method was used for gene quantification.

Thorpe H., Akhlaq M., Jackson D., Al Ghamdi S., Storr S., Martin S, & Ilyas M. (2015). Multiple pathways regulate Cten in colorectal cancer without a Tensin switch. International journal of experimental pathology, 96(6).

+ Open protocol

+ Expand

Profiling Sea Cucumber Developmental Genes

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA was isolated from 2-dpf and 4-dpf larvae of P. parvimensis using the Total Mammalian RNA Miniprep kit (Sigma-Aldrich) and converted to first-strand cDNA with the iScript Select cDNA Synthesis kit (Bio-Rad). Primers were designed against the P. parvimensis sea cucumber OSC genes LDS and PS such that the PCR products were 500–1,000 nucleotides long and the reverse primers had T7 or SP6 tails. The cDNA from the desired stages were used as a template for PCR. Antisense digoxigenin (DIG)-labeled RNA probes were synthesized from PCR products specific to P. parvimensis LDS or P. parvimensis PS using the DIG RNA Labeling kit (Roche). The primers used are described in Supplementary Table 9.

Thimmappa R., Wang S., Zheng M., Misra R.C., Huang A.C., Saalbach G., Chang Y., Zhou Z., Hinman V., Bao Z, & Osbourn A. (2022). Biosynthesis of saponin defensive compounds in sea cucumbers. Nature Chemical Biology, 18(7), 774-781.

+ Open protocol

+ Expand

Detect Sea Cucumber Developmental Genes

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA was isolated from 2 dpf and 4 dpf larvae of P. parvimensis using the Total Mammalian RNA Miniprep kit (Sigma-Aldrich) and converted to first strand cDNA with the iScript Select cDNA Synthesis kit (BioRad). Primers were designed against the P. parvimensis sea cucumber OSCs PpLDS and PpPS, such that the PCR products were 500-1000 nt long and the reverse primers had T7 or SP6 tails. The cDNA from the desired stages were used as a template in PCR. Antisense digoxigenin (DIG)-labeled RNA probes were synthesized from PCR products specific to PpLDS or PpPS using the DIG RNA labeling kit (Roche). The primers used are given in Supplementary Table 9.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!