Extracted DNA and cDNA samples were amplified by nested PCR in triplicate. Briefly, touch-up gradient PCR using primers SISP3 and SIS3 (Table S1) was used as the first-round amplification in a 50 μL reaction mix containing 6.5 μL template, 1 × Taq buffer (Applied Biosystems), 2 mM MgCl2 (Applied Biosystems), 0.5 mM dNTP (Sigma-Aldrich), 1 U Taq DNA polymerase (Roche Diagnostics), and 0.8 μM of each primer. The PCR reaction was performed for one cycle at 94 °C for 3 min, followed by 12 cycles touch-up PCR with 94 °C for 30 s and 20 °C for 190 s (2 °C increase per cycle), followed by 30 cycles of 94 °C for 30 s, 48 °C for 30 s, and 68 °C for 2 min, and with a 5 min final extension at 68 °C. Five microliters of the first-round PCR product were further amplified with the primers SISP2 and SIS2 (Table S1) in a 50 μL reaction mix containing 1 × Taq buffer (Applied Biosystems), 2 mM MgCl2 (Applied Biosystems), 0.5 mM dNTP (Sigma-Aldrich), 1 U Taq DNA polymerase (Roche Diagnostics), and 0.8 μM of each primer. The PCR was performed with an initial denaturation at 94 °C for 3 min followed by 45 cycles of 94 °C for 30 s, 55 °C for 30 s, and 68 °C for 2 min, and with a 5 min final extension at 68 °C. The triplicates were pooled, and the PCR products were visualized by 1.5% agarose gel electrophoresis.
Taq dna polymerase
Manufactured by Roche
Sourced in Germany, United States, Switzerland, United Kingdom
Taq DNA polymerase is a thermostable enzyme derived from the bacterium Thermus aquaticus. Its primary function is to catalyze the synthesis of new DNA strands during the polymerase chain reaction (PCR) process, which is a widely used technique in molecular biology and genetics.
Automatically generated - may contain errors
Lab products found in correlation
Trizol, by Thermo Fisher Scientific (9 mentions)
Qiaprep spin miniprep kit, by Qiagen (8 mentions)
Trizol reagent, by Thermo Fisher Scientific (7 mentions)
Superscript 3 reverse transcriptase, by Thermo Fisher Scientific (6 mentions)
Phusion high fidelity dna polymerase, by Thermo Fisher Scientific (5 mentions)
Mgcl2, by Roche (4 mentions)
Dntps, by Thermo Fisher Scientific (4 mentions)
Rneasy mini kit, by Qiagen (4 mentions)
Boric acid, by Merck Group (4 mentions)
Wizard genomic dna purification kit, by Promega (4 mentions)
Restriction endonuclease, by New England Biolabs (4 mentions)
Nanodrop one, by Thermo Fisher Scientific (4 mentions)
M mlv reverse transcriptase, by Thermo Fisher Scientific (4 mentions)
Rq1 dnase, by Promega (3 mentions)
Qiaquick gel extraction kit, by Qiagen (3 mentions)
High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (3 mentions)
Dansylcadaverine, by Merck Group (3 mentions)
Tetracycline, by Merck Group (3 mentions)
Cellfectin 2, by Thermo Fisher Scientific (3 mentions)
Coomassie brilliant blue, by Merck Group (3 mentions)
160 protocols using taq dna polymerase
1
Nested PCR Amplification of DNA and cDNA
2
Construction and Verification of Recombinant pGKL Elements
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All of the strains used in this study are listed in Table 2 . Escherichia coli cells were grown at 37°C in 2xTY medium which was supplemented with kanamycin (50 μg/ml) or ampicilin (100 μg/ml) for selection of transformants. Transformations of E. coli cells were performed by electroporation using Gene Pulser Xcell (Bio-Rad). K. lactis cells were grown at 28°C in YPD medium which was supplemented with G418 (250 μg/ml) and/or hygromycin B (200 μg/ml) for selection of transformants. Transformations of K. lactis cells were performed using the one-step LiCl method [75 (link)] and followed by five-hour incubation in non-selective conditions immediately after transformation. For detailed descriptions of plasmids and elements used in this study see S1 Table . Constructed pGKL elements were verified by PCR and subsequent sequencing of amplified products.
The nucleotide sequences of the primers used for construction, verification and sequencing of recombinant pGKL elements, and RACE-PCR amplification are listed inS2 Table . All polymerase chain reactions (PCRs) were performed using Taq DNA polymerase (Roche). PCRs for construction of recombinant pGKL elements were performed using mixture of Taq DNA polymerase (Roche) and Pwo DNA polymerase (Roche) in a 99:1 volume ratio, respectively.
The nucleotide sequences of the primers used for construction, verification and sequencing of recombinant pGKL elements, and RACE-PCR amplification are listed in
3
Strain-level Differentiation of Saccharomyces cerevisiae
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
S. cerevisiae isolates were differentiated at the strain level by the interdelta region analysis, as described by Legras and Karst [22 (link)], using the primer set delta 12 (5′–TCAACAATGGAATCCCAAC-3′) and delta 21 (5′-CATCTTAACACCGTATATGA-3′). Sixteen commercial S. cerevisiae starters, including strains that are frequently applied in this area, were also analyzed (Supplementary Table S1 ). Amplification of genomic sequences flanked by delta elements of retrotransposons TY1 and TY2 was carried out by PCR in a final volume of 25 μL, containing 20 ng of DNA, 1x Buffer Kapa A, 2.5 mM MgCl2, 2× BSA, 25 pmol of each primer, 0.2 mM of each dNTP and 1 U of Taq DNA polymerase (KAPA Biosystems, Woburn, Massachusetts, USA). Amplification was performed in a Bio-Rad thermal cycler (T100TM Thermal Cycler, Bio-RAD Laboratories, Emeryville, CA, USA) under the following conditions: initial denaturation at 94 °C for 3 min, followed by 35 cycles of denaturation at 94 °C for 30 s, annealing at 46 °C for 30 s, and extension at 72 °C for 90 s, before a final extension at 72 °C for 10 min. The reaction products were separated on 2% agarose gel and visualized by UV light (GelDoc system, Bio-RAD Laboratories, Emeryville, CA, USA) using a 100 bp DNA ladder (New England Biolabs, Inc., Ipswich, MA, USA) as a molecular size standard.
4
RT-PCR Analysis of Neuronal Markers
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using ISOGEN and reverse-transcribed for single-strand cDNA,
using oligo (dT) primer and Superscript III reverse transcriptase (Invitrogen) according
to the manufacture’s instruction. PCR was performed using Taq DNA
polymerase (KAPA Biosystems, Woburn, MA, USA) and specific primers, and each cycle
consisted of the following steps: denaturation at 98°C for 10 s, annealing at 57°C to 65°C
for 30 s, and elongation at 72°C for 30 s (Table
1 Primer sequences used in RT-PCR
visualized with ethidium bromide.
using oligo (dT) primer and Superscript III reverse transcriptase (Invitrogen) according
to the manufacture’s instruction. PCR was performed using Taq DNA
polymerase (KAPA Biosystems, Woburn, MA, USA) and specific primers, and each cycle
consisted of the following steps: denaturation at 98°C for 10 s, annealing at 57°C to 65°C
for 30 s, and elongation at 72°C for 30 s (
1
| Gene | Primer sequence (5’-3’) | Anealing temperature | Product length (bp) | |
|---|---|---|---|---|
| TUBB3 | Forward | 5’-GGCCTCCTCTCACAAGTATGT-3’ | 58°C | 167 |
| Reverse | 5’-CGCCCTCTGTATAGTGC-3’ | |||
| NEFM | Forward | 5’-AGGCTGAGTCCCCAGTGAAA-3’ | 58°C | 220 |
| Reverse | 5’-TCCACCTCCCCATTGATAGC-3’ | |||
| MAP2 | Forward | 5’-ACCTTCCTCCATCCTCCCTC-3’ | 57°C | 151 |
| Reverse | 5’-AGTAGGTGTTGAGGTGCCGC-3’ | |||
| GFAP | Forward | 5’-ACATCGAGATCGCCACCTAC-3’ | 58°C | 228 |
| Reverse | 5’-GCACACCTCACATCACATCC-3’ | |||
| HPRT | Forward | 5’-AATGTCTGTTGCTGCGTC-3’ | 55°C | 92 |
| Reverse | 5’-TGTCTGTCTACAAGGGAAG-3’ |
visualized with ethidium bromide.
5
Molecular Detection of Mycobacterium tuberculosis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA was extracted following the method by Yates, Drobniewski, & Wilson, 2002 and amplified using the Polymerase Chain Reaction (PCR) targeting the 240‐bp region of the mpb64 gene using the outlined primer sequences F(460‐479) 5′‐TCCGCTGCCAGTCGTCTTCC‐3′ and R (700‐681) 5′‐GTCCTCGCGAGTCTAGGCCA‐3′ (Madhavan et al., 2000 ). The amplification was done in a 25‐μl reaction mixture, which consisted of 2.5 μl of 5× buffer (500 mmol/L potassium chloride, 100 mmol/L Tris chloride, 15 mmol/L magnesium chloride, gelatin 0.1%, pH 8.3), 100 ng each of primers, 200 mmol/L of each deoxyribonucleotide triphosphate, 1 U Taq DNA polymerase (Kapa Biosystems, South Africa), and 5 μl of DNA template. Nuclease‐free water was added to make the total volume to 25 μl. Amplification was executed using thermal cycler MyCycler™ (BioRad, Cape Town, South Africa). The protocol entailed of one cycle at 94°C for 5 min, 35 cycles of denaturation at 94°C for 1 min, annealing for 1 min at 55°C, and extension for 1 min at 72°C followed by one cycle of final extension at 72°C for 10 min (Madhavan et al., 2000 ).
6
Quantitative PCR Analysis of Bone Markers
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Tibial RNA was isolated using TRIzol reagent (Thermo Fisher Scientific, Inc., Waltham, MA, USA). Aliquots (1 μg) of total RNA were reverse-transcribed using SuperScript III Reverse Transcriptase (Invitrogen, Carlsbad, CA, USA). The resulting cDNA was used to determine the tibial mRNA levels of BMP-2, RUNX2, osteocalcin, COL-1, RANK, RANKL, TRAP, and cathepsin K by PCR amplification using Taq DNA polymerase (KAPA Biosystems, Wilmington, MA, USA). Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as an internal control. Primer sequences were as follows: GAPDH: 5’-AACTCCCATTCCACCTT-3’, 5’-GAGGGCCTCTCTCTTGCTCT-3’; BMP-2: 5’-AAGGCACCCTTTGTATGTGGACT-3’, 5’-CATGCCTTAGGGATTTTGGA-3’; RUNX2: 5’-TCCAGCCACCTTCACTTACAC-3’, 5’-GCGTCAACACCATCATTCTG-3’; osteocalcin: 5’-AGCTCAACCCCAATTGTGAC-3’, 5’-AGCTGTGCCGTCCATACTTT-3’; COL-1: 5’-TTGACCCTAACCAAGGATGC-3’, 5’-CACCCCTTCTGCGTTGTATT-3’; RANK: 5’-GTGACTCTCCAGGTCACTCC-3’, 5’-GGCAGACACACACTGTCG-3’; RANKL: 5’-ACGCAGATTTGCAGGACTCGAC-3’, 5’-TTCGTGCTCCCTCCTTTCATC-3’; TRAP: 5’-CGCCAGAACCGTGCAGA-3’, 5’-TCAGGCTGCTGGCTGAC-3’. PCR products were analyzed by 1.2% agarose/ethidium bromide gel electrophoresis and were then photographed.
7
Genotyping Characterization of Chestnut Cultivars
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The eight previously mentioned genotypes were DNA typed by the analysis of simple sequence repeat markers (SSRs) at the Department of Agricultural, Food, and Forest Sciences (DISAFA) of the University of Torino. For each genotype, young leaves were collected from both donor plants cultivated in the open field in the Nebrodi area (Sicily, Italy) and from plants maintained at SAAF greenhouse with (16 samples in total). DNA was extracted following the procedure described by Doyle and Doyle (1987) . Samples were genotyped using a set of 10 SSR loci: CaT-B107, CaT-B501, CaT-B502, CaT-B503, CaT-B504, CaT-B505, CaT-B507, CaT-B508 (Boccacci et al., 2005 (link)), CaC-B020, and CaC-B028 (Bassil et al., 2005 (link)). PCR amplifications were performed in a volume of 15 μL containing 50 ng DNA, 0.5 U Taq-DNA polymerase (Kapa Biosystems, Wilmington, MA, United States), 1.5 μL 10X PCR Buffer, 2.2 mM MgCl2, 200 μM dNTPs, and 0.5 μM of each primer. PCR products were analyzed on a 3,130 Genetic Analyzer (Applied Biosystems, Foster City, CA, United States) and data analysis was performed with Gene Mapper 4.0 software; alleles were defined by their size in base pairs, by comparison with the standard size (Gene Scan 500 LIZ, Applied Biosystems).
8
Microsatellite Genotyping of Domestic Cats
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
We selected 13 unlinked microsatellite markers previously characterized in domestic cats (Menotti-Raymond et al. 1999 (link)). Forward primers for all loci were fluorescently labeled and PCRs optimized into three multiplexes (see Table S2 for details). Briefly, each PCR contained about 20 ng of genomic DNA, 0.2 U Taq DNA polymerase (Kapa Biosystems, supplied by Lasec, Cape Town, South Africa), 1 X PCR reaction buffer, 0.5 mm MgCl2, primers at specific concentrations (Table S2), with the final reaction volume adjusted to 10 μL with distilled water. All multiplex reactions were amplified using the following thermal cycle: an initial denaturation at 95°C for 3 min, followed by 30 cycles of initial denaturation at 95°C for 15 s, annealing at 60°C for 30 s, and elongation at 72°C for 30 s. A final extension was carried out at 72°C for 15 min. Successful amplification was verified using agarose gel electrophoresis. Purified PCR fragments were separated on an ABI Prism 3100 Genetic Analyzer (Applied Biosystems, Foster City, CA), using GENESCAN™-500 (-250) as an internal size standard (Appl-ied Biosystems). Allele sizes were visualized and scored using GENEMARKER v1.95 (SoftGenetics LLC, State College, PA).
9
Comprehensive RNA Extraction and qPCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was harvested from adherent cells using Trizol (Thermo Fisher Scientific/Invitrogen). RNA was subsequently treated with 50 units/ml of RQ1 DNase (Promega) at 37°C for 1 h to eliminate traces of genomic DNA. First-strand cDNA synthesis (RT) was typically performed in 10 μl reactions containing 2.5 μg of total RNA, 50 pmol of a random decamer primer (N10), 40 units of rRNAsin (Promega) and 100 units of SuperScript III reverse transcriptase (Thermo Fisher Scientific/Invitrogen) at 50°C for 1 h. Regular PCRs were carried out using Taq DNA polymerase (KAPA Biosystems) and amplification products were resolved by gel electrophoresis in 2% agarose gels. Quantitative PCR (qPCR) assays were done in triplicate using SYBR® FAST qPCR Master Mix (KAPA Biosystems) and a StepOnePlus real-time PCR system (Applied Biosystems) and the signals were normalized to Gapdh mRNA levels. All primer sequences are provided in Supplementary Table S4 .
10
Extraction and Characterization of Medicinal Plant Compounds
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
We procured dried Glycyrrhiza uralensis and Platycodon grandiflorus roots, as well as dried plants without roots, from Andrographis paniculata, Centella asiatica, Gynostemma pentaphyllum, Polygonum chinense, Portulaca oleracea, Saururus chinensis, Smilax china, and Taraxacum campylodes from a reputable Chinese medicinal herb store in Taiwan (July 2020). Taq DNA polymerase was obtained from Kapa Biosystems (Roche, Basel, Switzerland). pMetLuc2 plasmid DNA and Ready-To-Glow™ Secreted Luciferase Reporter System were obtained from Clontech (Mountain View, CA, USA). Bovine serum albumin (BSA), T4 DNA ligase, and restriction enzymes (BglII and BamHI) were purchased from Promega (Madison, WI, USA). Gancaonin G and licoisoflavone A were obtained from ChemFaces (Wuhan, Hubei, China). Cudraflavone-C was purified in Dr. Liang’s laboratory (Figure S1 ). Methylthiazoletetrazolium (MTT), dimethyl sulfoxide (DMSO) and Geneticin™ selective antibiotic (G418 sulfate) were obtained from Sigma (St Louis, MO, USA). Dulbecco’s Modified Eagle Medium (DMEM) and fetal bovine serum (FBS) were obtained from Hyclone (Logan, UT, USA). Ethanol was obtained from J. T. Baker (Phillipsburg, NJ, USA). In this study, all other chemicals and solvents utilized were of reagent or high-performance liquid chromatography (HPLC) quality.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!