Isolation of naive CD4+ T cells from the mice spleen and differentiation into Th17/Treg cells in vitro were conducted according to our previously reported method with minor modifications (23 (link)). CD4+ T cells from splenic lymphocyte were magnetically enriched by a CD4+ T Cell Isolation Kit (Miltenyi, 130-104-454, Germany) with Columns (LS Column, Miltenyi, 130-042-401). Sorted naive CD4+ T cells were cultured for 5 days in 24-well plates in 1640 medium (including 10% fetal bovine serum and 1% penicillin–streptomycin solution) before supplemented with 10 μg/ml anti-CD3 (Bio X Cell, BE0001-1, USA) and 10 μg/ml anti-CD28 (Bio X Cell, BE0015-1). Th17 stimulations were complemented with 40 ng/ml IL-6 (Novoprotein, CG39), 1 ng/ml TGF-β1 (Novoprotein, CA59), 40 ng/ml IL-23 (Novoprotein, CS31), 20 μg/ml anti-IL-4 (Bio X Cell, BE0045), and 20 μg/ml anti-IFN-γ (Bio X Cell, BE0055). Treg stimulations were supplemented with 5 ng/ml TGF-β1 (Novoprotein, CA59), 20 ng/ml IL-2 (Novoprotein, CK24), 10 μg/ml anti-IL-4 (Bio X Cell, BE0045), and 10 μg/ml anti-IFNγ (Bio X Cell, BE0055).
Tgf β1
Manufactured by Novoprotein
Sourced in China
TGF-β1 is a recombinant human protein. It is a member of the transforming growth factor beta family.
Automatically generated - may contain errors
Lab products found in correlation
Dulbecco s modified eagle s medium, by Thermo Fisher Scientific (4 mentions)
α sma, by Abcam (2 mentions)
Tgf β1, by American Type Culture Collection (2 mentions)
Cck 8 assay, by GLPBIO (2 mentions)
Fetal bovine serum (fbs), by Thermo Fisher Scientific (2 mentions)
Streptomycin, by Thermo Fisher Scientific (2 mentions)
Multiskan go, by Thermo Fisher Scientific (2 mentions)
Fibronectin, by Cell Signaling Technology (1 mentions)
Lipofectamine 3000 transfection reagent, by Thermo Fisher Scientific (1 mentions)
Collagen 1, by Cell Signaling Technology (1 mentions)
Goat anti rabbit igg hrp, by Abcam (1 mentions)
Hrp goat anti mouse igg, by ABclonal (1 mentions)
α sma, by Boster Bio (1 mentions)
Gapdh, by ABclonal (1 mentions)
Udp glcua, by Merck Group (1 mentions)
Sb431542, by Selleck Chemicals (1 mentions)
Hepg2, by American Type Culture Collection (1 mentions)
Plc prf 5, by American Type Culture Collection (1 mentions)
Sk hep1, by American Type Culture Collection (1 mentions)
Hep3b, by National Collection of Authenticated Cell Cultures (1 mentions)
33 protocols using tgf β1
1
Isolation and Differentiation of Murine Th17/Treg Cells
2
Silencing hsa-circ-0044226 in TGF-β1-activated HFL1 fibroblasts
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
HFL1 human fibroblast cells were purchased from PROCELL and cultured in Ham's F12K medium supplemented with 10% fetal bovine serum (FBS), 100 U/ml penicillin, and 100 μg/ml streptomycin. The cells were maintained at 37 °C in a humidified atmosphere containing 5% CO2. To silence hsa-circ-0044226, 40,000 HFL1 cells were seeded in each well of a 6-well plate and cultured in Ham's F12K medium supplemented with 10% FBS. The cells were then activated with 10 ng/ml TGF-β1 (Novoprotein) for 24 h. Subsequently, HFL1 cells were transfected with hsa-circ-0044226-specific siRNA (5’TGAGGTGTTGTACATGCATTATAA3’) or scramble RNA using Lipofectamine™ 3000 Transfection Reagent (Thermo Fisher Scientific, Cat#L3000-015) following the manufacturer's instructions. After 24 h, the cells were collected for RT-qPCR and Western blot analyses, according to the manufacturer's instructions. The primary antibodies used for Western blotting included α-SMA (Boster Biological Technology, Cat#BM0002), fibronectin (Cell Signaling Technology, Cat#26836S), collagen I (Cell Signaling Technology, Cat#84336), and GAPDH (Abclonal, Cat#A19056). The secondary antibodies used were goat anti-mouse IgG-HRP (Abclonal, Cat#AS003) and goat anti-rabbit IgG-HRP (abcam, Cat#ab6721).
3
Preparation of TGF-β1 Solution
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Bleomycin (BLM) sulfate was purchased from Chengdu Synguider Technology Co., Ltd (Chengdu, China). Nintedanib was from Chengdu Giant Pharmaceutical Technology Co., Ltd (Chengdu, China). TGF-β1 was purchased from Novoprotein (Shanghai, China). Ten micrograms of TGF-β1 was added into 100 μl sterile ddH2O and mixed well. Then 0.1 g/L TGF-β1 solution was kept at −80°C.
4
Mouse Hepatocyte TGF-β1 Treatment
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
AML12 mouse hepatocytes, which are immortalized normal mouse hepatocytes, were purchased from WHELAB (Shanghai, China). The cells were cultured in Dulbecco’s Modified Eagle’s Medium (Gibco, Gaithersburg, MD, USA) supplemented with 1% ITS Liquid Media Supplement, 40 ng/mL dexamethasone, 10% heat-inactivated fetal bovine serum (BI, Israel; VivaCell, Shanghai, China), 1% penicillin/streptomycin, and bicarbonate at 37 °C under 5% CO2. AML12 cells were divided into five groups: control, transforming growth factor beta1 (TGF-β1, Novoprotein, Suzhou, China) at concentrations of 5, 10, and 20 ng/mL. Each treatment was for an additional 48 h.
5
Ivermectin Cytotoxicity and HSC Activation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
CFSC, a rat HSC cell line, was grown in DMEM supplemented with 10% FBS. The cells were maintained in a cell incubator with 5% CO2 under 37 °C. For the cell viability assay, the CFSC cells were treated with ivermectin (3 μM, 6 μM, 12 μM, 25 μM) for 48 h. For the HSC activation assay, the CFSC cells were pretreated with ivermectin at concentrations of 3 μM and 6 μM for 1 h and then treated with TGFβ1 (10 ng/mL; Novoprotein, Shanghai, China) for another 48 h.
6
Effects of UDP-GlcUA and UDP-Glc on Hepatoma Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Human HCC cell lines SK‐Hep1, SNU449, HepG2 and PLC/PRF/5 were obtained from the American Type Culture Collection (VA, USA); Hep3B, Huh7, HEK293T from the Cell Bank of the Chinese Academy of Sciences (Shanghai, China). Immortalized human hepatocytes (MIHA) was a gift from Dr. Ben C.B. Ko (The Hong Kong Polytechnic University). All cell lines were tested negative for mycoplasma. Serum‐starved hepatoma cells were treated with or without UDP‐GlcUA (0.5–1.0 mM, Sigma‐Aldrich U6751), UDP‐Glc (1–5 mM, Millipore 670120), Transforming growth factor beta 1 (TGFβ1, 10 ng/ml, Novoprotein Scientific Inc) or SB431542(10 μM, Selleckchem) for the indicated time.
7
Establishing Lung Metastasis Model in Mice
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To establish an experimental lung metastasis model, the cells were resuspended in PBS (1×106 cells/100 µl/mouse) and injected cells into each mouse (6 weeks old, female, BALB/c, n=6/group) via the tail vein on day 0. The mice were then injected with TGF-β1 (Novoprotein Scientific) (400 ng/µl) into their abdominal cavity every 5 days, and the total number of injections was 5 times. Mice were maintained in exhaust ventilated closed system cages in a specific pathogen-free environment, with 55±5% humidity, at 23±2°C. Food and water were provided ad libitum. All the mice were sacrificed 50 days after tail vein injection. Surgically resected mouse lung tissues were fixed in Bouin's fluid (Thermo Scientific) and the number of pulmonary metastasis nodules were counted under a microscope (CKX41; Olympus) after the appropriate tissues were stained with hematoxylin and eosin (H&E; Beyotime) at room temperature for 10 min. All animal experiments were carried out in accordance with the Guide for the Care and Use of Experimental Animals from the Experimental Animal Center of Xuzhou Medical University. Experiments on Animals were approval by the Animal Ethical Committee of Xuzhou Medical University.
8
Antibodies and Reagents for TGF-β1 Signaling
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Antibodies and reagents TGF-β1 was purchased from Novoprotein (Beijing, China). SIS3 was acquired from MedChemExpress (MCE, CA). Antibodies against collagen I, α-SMA,ELAVL1 and GAPDH were obtained from Abcam (CA). Anti-phospho-Smad3 (p-Smad3), anti-Smad3, and β-tubulin were purchased from A nity (Changzhou, China).
9
Breast Cancer Cell Culture and Manipulation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Human breast cancer cell lines MDA-MB-231, SK-BR-3, and MCF-7 were obtained from the Shanghai Institute of Biochemistry and Cell Biology, Chinese Academy of Sciences. The LD cell line was established by our laboratory (Department of Pathogenic Biology and Immunology, School of Medicine, Southeast University, Nanjing, China) from a human breast cancer postsurgery sample (8 (link)). All cells were cultured in Dulbecco's modified Eagle's medium containing 10% fetal bovine serum (GibcoTM; Thermo Fisher Scientific, Inc.). Lipofectamine™ 2000 reagent was obtained from Invitrogen; Thermo Fisher Scientific, Inc. TGF-β1 (Novoprotein Scientific, Inc.) and SB431542 (selective inhibitor of TGF-βRI) (cat. no. A8249; APeXBIO Technology LLC) were used to treat cells.
10
Apoptosis Regulation by MORC2 and SMAD4
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DMEM/F12 and penicillin/streptomycin (Life Technologies Co., Carlsbad, CA, USA), HighGene Transfection reagent (ABclonal, Wuhan, China), RNAiso Plus, and a PrimeScript™ RT reagent Kit with gDNA Eraser (Perfect Real Time) (Taraka, Dalian, China), a One Step TUNEL Apoptosis Assay Kit and a BCA Protein Assay Kit (Beyotime Biotechnology, Shanghai, China), a Dual-Luciferase Reporter Assay Kit (Vazyme, Nanjing, China), TGF-β1 (NovoProtein, Suzhou, China), an anti-MORC2 rabbit polyclonal antibody (Sangon Biotech, Shanghai, China), an anti-SMAD4 rabbit polyclonal antibody (Santa Cruz Biotechnology, Shanghai, China), and PVDF membrane (Merck Millipore, Darmstadt, Germany) were purchased from the indicated suppliers.Primers were synthesized by Shangya (Hangzhou, China). siRNAs were synthesized by GenePharma (Shanghai, China). NovoStart® SYBR qPCR SuperMix Plus was purchased from Novoprotein (Nanjing, China).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!