Human DDX17 pcDNA3.1(+) plasmid, control vector pcDNA3.1(+), human BACE1 +5′UTR (containing the 5′UTR and the entire human BACE1 coding region) pcDNA3.1(+), and human BACE1-5′UTR (only containing the entire human BACE1 coding sequence) pcDNA3.1(+) were obtained from YouBio (Changsha, China). The BACE1 +5′UTR-pmirGLO and BACE1 −5′UTR-pmirGLO were from Sangon Biotech (Shanghai, China). The siRNA oligonucleotide sequences for DDX17 (SiDDX17) and non-targeting control (NC) were designed by GenePharma Biotech (Shanghai, China) as follows: SiDDX17 (sense: GCUGCUUAUGGCACCAGUAGCUAUA; antisense: UAUAGCUACUGGUGCCAUAAGCAGC); and NC (sense: UUCUCCGAACGUGUCACGUTT; antisense: ACGUGACACGUUCGGAGAATT). Cells were transfected with LipofectamineTM 3000 (Invitrogen, USA) or LipofectamineTM RNAiMAX Transfection Reagent (Invitrogen, Carlsbad, CA, USA) mixed with Opti-MEMTM Reduced Serum Media (Gibco, Rockville, MD, USA) according to the manufacturer’s protocols.
Pcdna3
Manufactured by YouBio
Sourced in China
PcDNA3.1 is a plasmid vector designed for high-level expression of recombinant proteins in mammalian cells. It contains a strong CMV promoter, a multiple cloning site, and a neomycin resistance gene for selection of stable cell lines.
Automatically generated - may contain errors
Lab products found in correlation
Lipofectamine 3000, by Thermo Fisher Scientific (2 mentions)
Lipofectamine rnaimax transfection reagent, by Thermo Fisher Scientific (1 mentions)
Bace1 5 utr pmirglo, by Sangon (1 mentions)
Opti memtm reduced serum media, by Thermo Fisher Scientific (1 mentions)
Lipofectamine 2000, by Thermo Fisher Scientific (1 mentions)
Lipofectamine 3000 reagent, by Thermo Fisher Scientific (1 mentions)
Pgl3 plasmid, by Promega (1 mentions)
Endotoxin free plasmid extraction kit, by Tiangen Biotech (1 mentions)
6 protocols using pcdna3
1
Plasmids and siRNA for DDX17 and BACE1
2
Functional Analysis of miR-1200 and circRNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A miR-1200 inhibitor, negative control (NC) inhibitor, miR-1200 mimics, mimics NC, small interfering RNA (si)-NC, and si-circ_0074673 were synthesized by Ribobio (Guangzhou, China). For the study, pcDNA3.1 was purchased from YouBio (Changsha, China), and pcDNA3.1-MEOX2 was structured. HG-HUVACs were seeded into 6-well plates before 24 h of transfection. Lipofectamine 3000 (Invitrogen) was used for transient transfection, according to the supplier’s instructions. The cells were collected after 48 h of transfection for further analysis.
3
miR-485-5p Regulation in Esophageal Cancer
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
KYSE 30, Eca 109 and TE-1 cell lines (at 70% density), were transfected with 100 nM miR-485-5p mimics (cat. no. miR10002175-1-5; Guangzhou RiboBio Co., Ltd.), miRNA mimic negative controls (mimics-NC; cat. no. miR1N0000001-1-5; Guangzhou RiboBio Co., Ltd.), miR-485-5p inhibitor (cat. no. miR20002175-1-5; Guangzhou RiboBio Co., Ltd.), miRNA inhibitor negative controls (inhibitor-NC; cat. no. miR2N0000001-1-5; Guangzhou RiboBio Co., Ltd.), FLOT-1 plasmid (2 µg/well; YouBio) and pcDNA 3.1 (2 µg/well; YouBio) using Lipofectamine® 2000 (Invitrogen; Thermo Fisher Scientific, Inc.), according to the manufacturer's instructions. The time interval between transfection and subsequent experimentation was 48 h.
4
Validation of miR-181d-5p Target Site
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
MiR-181d-5p mimics and inhibitors were constructed from RiboBio (Guangzhou, China). The RNF43 vector contained a 200 bp fragment of its 3′-UTR with miR-181d-5p binding sites, and the control empty plasmid (pcDNA3.1) were constructed and purchased from YouBio (Changsha, China). Transfection was carried out with Lipofectamine 3000 reagents (Invitrogen).
5
Brucella abortus and E. coli Culture
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Brucella abortus wild-type strain 2308 (S2308) (The Center of Chinese Disease Prevention and Control, Beijing, China) was cultured in tryptic soy broth (TSB) or tryptic soy ager (TSA) (Difco, MI, USA) at 37°C in 5% CO2 incubator, the Brucella strain was manipulated in a biosafety level 3 laboratory. Escherichia coli DH5α (The Center of Chinese Disease Prevention and Control, Beijing, China) was cultured in Luria-Bertani medium, when appropriate, 100 μg/mL of ampicillin or kanamycin was added to the culture medium. pcDNA3.1 (Youbio,Wuhan, China) and pGL3 plasmid (Promega, Beijing, China), and other constructed plasmids were extracted using Endotoxin-free plasmid extraction kit (TianGen, Beijing, China) for cells transfection.
6
Cloning and Validation of Kv4 and DPP6 Constructs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
cDNAs coding for human Kv4.3 (NM_172198), Kv4.2 (NM_012281), KChIP2 (NM_173192), DPP6‐L (long isoform; NM_130797), and DPP6‐S (short isoform; NM_001936) were cloned into pcDNA3.1 by Youbio (Changsha, China). Alanine substitution at positions R7, P33, D36, G38, L44 in DPP6‐L was performed by Youbio. Validity of all cDNA constructs was confirmed by sequencing.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!