Pgfp c shlenti

Short hairpin RNA (shRNA) lentiviral plasmids (pGFP-C-shlenti) against mouse Gpr116 were purchased from Origene (CAT#: TL517926), and four 29mer shRNA sequences were used for silencing mouse Gpr116 TL517926A (TL517926A) 5’-tactccattcacaccactgtcatcaacaa-3’ (SEQ ID NO.: 13), TL517926B (TL517926B) 5’-tcgcagtgttctgccacttcaccaatgca-3’ (SEQ ID NO.: 14), TL517926C (TL517926C) 5’-cgtcatcttagacaagtctgccttgaact-3’ (SEQ ID NO.: 12), and TL517926D (TL517926D) 5’-tgtggctggtgctatccacgacggtcgct-3’ (SEQ ID NO.: 15), and a non-effective 29-mer scrambled shRNA cassette in pGFP-C-shlenti Vector, (CAT#: TR30021) 5’-gcactaccagagctaactcagatagtact-3’ (SEQ ID NO.: 16) was used as a control. For virus production, shRNA lenti vectors were cotransfected O/N, with packaging plasmids psPAX2 (Addgene) and PMD2.G (Addgene) to HEK293FT cells, using Lipofectamine 3000. Twenty-four hours later, media was changed by DMEM 10% FBS containing 1% BSA. After 24 h, the supernatant was recovered, filtered with 0.45 mm filters, and used to infect differentiated mature primary adipocytes. One milliliter of the supernatant was added in 1 well of a 12-well plate for 24 h. After that, the media was changed to complete DMEM media. GPR116 mRNA levels were more than 70% deleted, compared to the scrambled control and it was achieved as early as 72 h post infection.

The KIF5B-targeting shRNA [shRNA KIF5B] #1, [TL510740B, 5’-ACTCTACGGAACACTATTCAGTGGCTGGA] and [shRNA KIF5B] #2, [TL51074CB 5’ –AGACCGTAAACGCTATCAGCAAGAAGTAG] are in the plasmid backbone pGFP-C-shLenti and were from Origene (Rockville, MD). The non-targeting shRNA control, was pGFP-C-shLenti also from Origene.

MED10-Human, 4 unique 29mer shRNA constructs in lentiviral GFP vector containing pGFP-C-shLenti (#TL303299; MED10 Human shRNA Plasmid Kit (Locus ID 84246; OriGene Technologies Inc., Rockville, MD, USA) were packaged and transfected into SW1738 or JMSU1 cells to silence MED10. Non-effective 29-mer scrambled shRNA cassette in pGFP-C-shLenti Vector, TR30021, served as negative control. Stably transfected monoclonal SW1738 or JMSU1 cells were selected using 2 μg/ml puromycin, as recommended by the manufacturer. The effect of the lentiviral infection was enhanced by adding Sigma-Aldrich^® polybrene (#TR-1003, Merck KGaA, Darmstadt, Germany). MED10 knockdown in the cells was verified by Western blotting and quantitative real-time PCR. The shRNA sequences for MED10 are as follows: shMED10#1 5′-GACAGCAGCTTCATGATATTA-3′, and shMED101#2 5′-ATCGACACCATGAAGAAATTT-3′.