Rabbit reticulocyte lysate system

Manufactured by Promega

Sourced in United States

The Rabbit Reticulocyte Lysate System is a cell-free protein synthesis system. It enables the in vitro translation of mRNA into proteins using a lysate derived from rabbit reticulocytes.

Automatically generated - may contain errors

Lab products found in correlation

Luciferase assay system, by Promega (4 mentions) Mmessage mmachine sp6 kit, by Thermo Fisher Scientific (3 mentions) T7 rna polymerase, by New England Biolabs (3 mentions) T7 rna polymerase, by Thermo Fisher Scientific (3 mentions) Tnt sp6 quick coupled kit, by Promega (2 mentions) Megaclear transcription clean up kit, by Thermo Fisher Scientific (2 mentions) 35s methionine, by PerkinElmer (2 mentions) Typhoon phosphorimager, by GE Healthcare (2 mentions) Glutathione sepharose 4b bead, by Cytiva (2 mentions) Biophotometer, by Eppendorf (2 mentions) Genejet rna purification kit, by Thermo Fisher Scientific (2 mentions) Glomax explorer system, by Promega (2 mentions) Fxr1 gst protein, by Novus Biologicals (2 mentions) C myc antibody, by Cell Signaling Technology (2 mentions) Dual luciferase reporter assay system, by Promega (2 mentions) Infinite m1000 plate reader, by Tecan (2 mentions) Luciferase reporter assay system, by Promega (2 mentions) Synergy ht multi detection microplate reader, by Agilent Technologies (2 mentions) Sucrose, by MP Biomedicals (1 mentions) Mmessage sp6 transcription kit, by Thermo Fisher Scientific (1 mentions)

Spelling variants of this product

Rabbit reticulocyte lysate (87 citations) Flexi Rabbit Reticulocyte Lysate System (36 citations) Rabbit reticulocyte lysate translation system (5 citations) TNT Coupled Rabbit Reticulocyte Lysate System (4 citations) Nuclease-treated rabbit reticulocyte lysate system (3 citations) TNT rabbit reticulocyte lysate system (3 citations) Rabbit Reticulocyte Lysate System Nuclease Treated kit (2 citations)

50 protocols using rabbit reticulocyte lysate system

In Vitro Protein Synthesis Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

For in vitro translation of
³⁵S-radiolabeled precursor proteins, plasmids carrying a SP6
promoter-binding region followed by the gene of interest were used. Plasmids
were incubated with the TNT SP6 quick coupled kit (Promega), an in
vitro eukaryotic transcription/ translation system based on
rabbit reticulocytes, and [³⁵S] methionine (PerkinElmer) for 2 hr
at 30°C and 300 rpm.
For the in vitro translation of
[³⁵S]Por1 the Rabbit Reticulocyte Lysate System (Promega) was
used. First, mRNA was synthesized by using the mMESSAGE mMACHINE SP6 kit
(Invitrogen) and cleaned up by the MEGAclear Transcription Clean-Up kit
(Invitrogen). Radiolabeled proteins were translated by using the Rabbit
Reticulocyte Lysate System (Promega) for 2 hr at 30°C and 300
rpm.
After translation, 20 mM unlabeled methionine (Roth) and 0.3 M
sucrose (MP Biomedicals) were added. Lysate was snap frozen in liquid
nitrogen and stored at –80°C.

Weinhäupl K., Lindau C., Hessel A., Wang Y., Schütze C., Jores T., Melchionda L., Schönfisch B., Kalbacher H., Bersch B., Rapaport D., Brennich M., Lindorff-Larsen K., Wiedemann N, & Schanda P. (2018). Structural Basis of Membrane Protein Chaperoning through the Mitochondrial Intermembrane Space. Cell, 175(5), 1365-1379.e25.

+ Open protocol

+ Expand

in vitro Translation of Radiolabeled Proteins

Check if the same lab product or an alternative is used in the 5 most similar protocols

For in vitro translation of ³⁵S-radiolabeled precursor proteins, plasmids carrying a SP6 promoter-binding region followed by the gene of interest were used. Plasmids were incubated with the TNT SP6 quick coupled kit (Promega), an in vitro eukaryotic transcription/translation system based on rabbit reticulocytes, and [³⁵S] methionine (PerkinElmer) for 2 hr at 30°C and 300 rpm.
For the in vitro translation of [³⁵S]Por1 the Rabbit Reticulocyte Lysate System (Promega) was used. First, mRNA was synthesized by using the mMESSAGE mMACHINE SP6 kit (Invitrogen) and cleaned up by the MEGAclear Transcription Clean-Up kit (Invitrogen). Radiolabeled proteins were translated by using the Rabbit Reticulocyte Lysate System (Promega) for 2 hr at 30°C and 300 rpm.
After translation, 20 mM unlabeled methionine (Roth) and 0.3 M sucrose (MP Biomedicals) were added. Lysate was snap frozen in liquid nitrogen and stored at −80°C.

+ Open protocol

+ Expand

In Vitro Mitochondrial Protein Import

Check if the same lab product or an alternative is used in the 5 most similar protocols

In vitro mRNA transcription and protein translation was performed using mMessage SP6 transcription kit (Ambion) and rabbit reticulocyte lysate system (Promega) respectively. In vitro translation was performed in the presence of ³⁵S-methionine. Mitochondrial in vitro protein import assays were performed as described (Ryan et al., 2001 (link)). Radiolabeled proteins were incubated with isolated mitochondria resuspended at 1 mg/ml in import buffer (20 mM HEPES-KOH (pH 7.4), 250 mM sucrose, 5 mM magnesium acetate and 80 mM potassium acetate) supplemented with 10 mM sodium succinate, 1 mM 1,4-dithiothreitol and 5 mM ATP. Protein import was performed at 37°C for the desired amount of time in the presence or absence of membrane potential. To dissipate the membrane potential, a final concentration of 10 μM of Carbonyl cyanide-p-trifluoromethoxyphenylhydrazone (FCCP; Sigma-Aldrich) was added to each import reaction. Import reaction was stopped at 4°C followed by incubation with 50 μg/mL of PK and subsequent treatment with 1 mM PMSF. Mitochondria were re-isolated and TCA precipitated for SDS-PAGE analysis or resuspended into digitonin-containing buffer for BN-PAGE analysis. Autoradiography was performed to visualise the radioactive signal using a Typhoon Phosphor Imager (GE Healthcare). Radioactive images were processed using Image J software.

Kang Y., Anderson A.J., Jackson T.D., Palmer C.S., De Souza D.P., Fujihara K.M., Stait T., Frazier A.E., Clemons N.J., Tull D., Thorburn D.R., McConville M.J., Ryan M.T., Stroud D.A, & Stojanovski D. (2019). Function of hTim8a in complex IV assembly in neuronal cells provides insight into pathomechanism underlying Mohr-Tranebjærg syndrome. eLife, 8, e48828.

+ Open protocol

+ Expand

Radiolabeling IA-2 Autoantigen for Immunoassay

Check if the same lab product or an alternative is used in the 5 most similar protocols

The [³⁵S]IA-2 tracer was obtained by in vitro transcription/translation of the _cDNA coding for human IA-2_iccloned into pSP64 vector (Promega, Madison, WI, USA), using a rabbit reticulocyte lysate system (Promega, Madison, WI, USA) in the presence of [³⁵S]-methionine (New England, Nuclear, Boston, MA, USA), according to the manufacturer’s instructions. Translation products were diluted in radioimmunoassay (RIA) buffer (0.02 M Tris-HCl, 0.15 M NaCl, 0.1 % v/v Tween 20, pH 7.4) and applied to a PD10 column (Pharmacia-LKB Biotechnology, Uppsala, Sweden) in order to remove free [³⁵S]-methionine. Typically, the percentage of incorporation of [³⁵S]-methionine to the protein by this method was 5–7 %, yielding about 5–7×10⁶cpm of labelled protein. The tracer was stored in aliquots at -40 °C, and had a shelf life of 5 weeks.

Guerra L.L., Faccinetti N.I., Trabucchi A., Rovitto B.D., Sabljic A.V., Poskus E., Iacono R.F, & Valdez S.N. (2016). Novel prokaryotic expression of thioredoxin-fused insulinoma associated protein tyrosine phosphatase 2 (IA-2), its characterization and immunodiagnostic application. BMC Biotechnology, 16, 84.

+ Open protocol

+ Expand

Mitochondrial Protein Import Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols

GFP, MTS–GFP, survivin_1–10–GFP and survivin–GFP were translated in vitro (IVT) from pcDNA templates using T7 RNA polymerase, incorporating [³⁵S]methionine using a rabbit reticulocyte lysate system (Promega). Radiolabelled proteins were incubated for 1 h at 37°C with mitochondria isolated from HeLa cells in import buffer [20 mM HEPES pH7.5, 3% (w/v) fatty acid-free BSA, 250 mM sucrose, 80 mM KCl, 5 mM MgCl₂ supplemented with 2 mM ATP and 10 mM sodium succinate], before washing in buffer or incubation in 150 µg/ml trypsin or trypsin plus 1% Triton X-100 (15 min, on ice).

Dunajová L., Cash E., Markus R., Rochette S., Townley A.R, & Wheatley S.P. (2016). The N-terminus of survivin is a mitochondrial-targeting sequence and Src regulator. Journal of Cell Science, 129(14), 2707-2712.

+ Open protocol

+ Expand

In vitro Protein Expression and Characterization

Check if the same lab product or an alternative is used in the 5 most similar protocols

Isolated total RNA from sorted cell types were in vitro translated into proteins by using Rabbit Reticulocyte Lysate System (Promega, Madison, WI, USA). Expressed proteins were applied for Ca²⁺ flux experiments. Regarding to ORF-1 expression, full-length of ORF-1 was inserted the expression plasmid pRSET vector (Invitrogen) as previously described [33 (link),34 (link)]. ORF-1 protein was translated in vitro by using TNT T7 Quick Coupled Transcription/Translation System (Promega). Quality of expressed protein is determined by using TranscendTM tRNA (Promega). Protein size is confirmed on an SDS-PAGE gel.

Zhang C., Raveney B., Takahashi F., Yeh T.W., Hohjoh H., Yamamura T, & Oki S. (2023). Pathogenic Microglia Orchestrate Neurotoxic Properties of Eomes-Expressing Helper T Cells. Cells, 12(6), 868.

+ Open protocol

+ Expand

Mitochondrial Protein Import Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols

Open reading frames encoding SFXN1, SFXN2, SFXN3, MTHFD2, SHMT2, or GC1 were cloned into pGEM4z and used for transcription with the mMESSAGE mMACHINE SP6 kit (Thermo Fisher Scientific) according to the manufacturer’s instructions. Radiolabeled protein was translated from mRNA using the rabbit reticulocyte lysate system (Promega) and ³⁵S-labeled methionine, according to the manufacturer’s instructions. Isolated mitochondria were resuspended in mitochondrial import buffer (250 mM sucrose, 5 mM magnesium acetate, 80 mM potassium acetate, 10 mM sodium succinate, 1 mM DTT, 5 mM ATP, 20 mM HEPES-KOH, pH 7.4), and imports were performed through incubation with radiolabeled proteins for the desired incubation time at 37°C and in the presence or absence of 10 μM FCCP (to dissipate membrane potential). Following import, each reaction was treated consecutively with proteinase K (50 μg/mL for 10 min on ice) and PMSF (1 mM for 5 min on ice) before reisolation for SDS–PAGE and BN-PAGE analysis. Radioactive signals were detected using a Typhoon phosphorimager (GE Healthcare). Analysis of autoradiography was performed using ImageJ software to calculate the intensity of each band. Background intensities were calculated by averaging the intensity of multiple areas of the gel away from the bands.

Jackson T.D., Hock D.H., Fujihara K.M., Palmer C.S., Frazier A.E., Low Y.C., Kang Y., Ang C.S., Clemons N.J., Thorburn D.R., Stroud D.A, & Stojanovski D. (2021). The TIM22 complex mediates the import of sideroflexins and is required for efficient mitochondrial one-carbon metabolism. Molecular Biology of the Cell, 32(6), 475-491.

+ Open protocol

+ Expand

Purification and In Vitro Ccnd1 Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

All of the GST fusions were expressed in E. coli BL21 (DE3) by adding 1 mM isopropyl-β-d-thiogalactopyranoside (IPTG) to LB broth cultures at a cell density of 0.3 A₆₀₀ and subsequent incubation for 4 h at 30 °C. The proteins were purified using glutathione-Sepharose 4B beads as directed by the supplier (Amersham Biosciences) in 500 μl of lysis buffer containing 50 mM HEPES, pH 7.5, 150 mM NaCl, 1 mM EDTA, 0.5% Triton X-100, 10% glycerol, 1 mM DTT, and protease and phosphatase inhibitors. Concentration and purity of substrates were estimated by comparison to protein standards stained with Coomassie Brilliant Blue.
For in vitro transcription and translation, Flag-Ccnd1 was amplified by PCR (forward primer: CGCGCTAATACGACTCACTATAGGGAGACCCAAGCCCATGGGATCAC; reverse primer: TTTTTTTTTTTTTTTTTTTTTTTTTTTTTGGCTGATCAGCGAGCTCTAG), transcribed in vitro with the T7 RNA polymerase (New England Biolabs), and in vitro-translated with a Rabbit Reticulocyte Lysate system (Promega).

Pedraza N., Monserrat M.V., Ferrezuelo F., Torres-Rosell J., Colomina N., Miguez-Cabello F., Párraga J.P., Soto D., López-Merino E., García-Vilela C., Esteban J.A., Egea J, & Garí E. (2023). Cyclin D1—Cdk4 regulates neuronal activity through phosphorylation of GABAA receptors. Cellular and Molecular Life Sciences, 80(10), 280.

+ Open protocol

+ Expand

Luciferase Synthesis in Cell-free System

Check if the same lab product or an alternative is used in the 5 most similar protocols

In order to determine protein synthesis of luciferase firefly from luc cmRNA (kindly provided by Ethris, Planegg, Germany) in a cell-free system, the Rabbit Reticulocyte Lysate System (Promega, Madison, WI) was applied according to the manufacturer’s instructions. Per reaction of 35 μL lysate, 1 μg luc cmRNA and either 0.1 μg AA or 0.1 μg AAstop cmRNA were employed simultaneously. After an incubation of 45 min at 30°C, luminescence was measured using Tecan InfiniteR 200 PRO (Tecan, Männedorf, Switzerland).

Hirschberger K., Jarzebinska A., Kessel E., Kretzschmann V., Aneja M.K., Dohmen C., Herrmann-Janson A., Wagner E., Plank C, & Rudolph C. (2018). Exploring Cytotoxic mRNAs as a Novel Class of Anti-cancer Biotherapeutics. Molecular Therapy. Methods & Clinical Development, 8, 141-151.

+ Open protocol

+ Expand

EGFP-3x Myc Protein Translation

Check if the same lab product or an alternative is used in the 5 most similar protocols

EGFP-3x Myc cDNA mRNA was in vitro transcribed from its cDNA cloned into pSP64 poly(A) using mMESSAGE mMACHINE (ThermoFisher, Waltham, MA). The mRNA was translated in the rabbit reticulocyte lysate system (Promega, Madison, WI) with or without 1 μM (final) MBP or MBP-TRAL proteins. Synthesized EGFP-3x Myc protein and MBP or MBP-TRAL proteins from the reaction were examined by immunoblot with anti-Myc (9E10; Covance, Princeton, NJ) or Anti-MBP antibody (Sigma-Aldrich, St. Louis, MO).

Hara M., Lourido S., Petrova B., Lou H.J., Von Stetina J.R., Kashevsky H., Turk B.E, & Orr-Weaver T.L. (2018). Identification of PNG kinase substrates uncovers interactions with the translational repressor TRAL in the oocyte-to-embryo transition. eLife, 7, e33150.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!