Primetime qpcr probe assay

Manufactured by Integrated DNA Technologies

Sourced in Belgium

PrimeTime qPCR Probe Assays are a set of pre-designed, pre-validated real-time PCR assays for gene expression analysis. They are designed to provide accurate and reliable quantification of target DNA sequences.

Automatically generated - may contain errors

Lab products found in correlation

Spelling variants of this product

PrimeTime qPCR assays (41 citations) PrimeTime qPCR probes (11 citations) PrimeTime assays (9 citations) PrimeTime Probe (4 citations) IDT PrimeTime qPCR Probe Assays (2 citations) PrimeTime© probe-based qPCR Assays (2 citations) PrimeTime qPCR primer/probe assays (2 citations)

16 protocols using primetime qpcr probe assay

Quantification of CFTR Transcripts

Check if the same lab product or an alternative is used in the 5 most similar protocols

Real-time qPCR was performed with PrimeTime Gene Expression Master Mix and PrimeTime qPCR probe assay kits human non-F508del-CFTR (Integrated DNA Technologies [IDT]; qhCFTR-ex11WTF, qhCFTR-ex12WTR, and hCFTR-F508) and human F508del-CFTR (IDT; qhCFTR-ex11ΔFF, qhCFTR-ex12ΔFR, and hCFTR-DF508) transcripts were normalized to human HPRT1 (IDT; Hs.PT.58v.45621572) (SI Appendix, Table S1). All reactions were analyzed in triplicate on 96-well plates and averaged together to comprise one replicate. Real-time PCR was performed on an Applied Biosystems ViiA 7 Real-Time PCR System. Results were analyzed by the ΔΔCT method (75 (link)).

Michaels W.E., Pena-Rasgado C., Kotaria R., Bridges R.J, & Hastings M.L. (2022). Open reading frame correction using splice-switching antisense oligonucleotides for the treatment of cystic fibrosis. Proceedings of the National Academy of Sciences of the United States of America, 119(3), e2114886119.

+ Open protocol

+ Expand

Lentiviral Titration in Cell Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols

Cells were plated in 24-well plates at a density of 1 × 10⁴ (link) cells/well and transduced with different amounts of virus. Cells were changed into fresh medium 6 h after the virus was added. The transduced cells were then expanded in M10 medium for subsequent experiments.
For lentivirus titration, genomic DNA of the cells was extracted using a DNeasy blood and tissue kit (Qiagen, Manchester, UK) according to the manufacturer’s instructions. Viral copy number within the transduced cells was determined using the Primetime qPCR probe assay (Integrated DNA Technologies, Leuven, Belgium). The primers and probes used for qPCR were WPRE-forward primer, TGGATTCTGCGCGGGA; WPRE-reverse, GAAGGAAGGTCCGCTGGATT; WPRE-probe, CTTCTGCTACGTCCCTTCGGCCCT; β-actin-forward primer, CAGCGGAACCGCTCATTGCCAATGG; β-actin-reverse primer, TCACCCACACTGTGCCCATCTACGA; and β-actin-probe, ATGCCCTCCCCCATGCCATCCTGCGT.

Meng J., Moore M., Counsell J., Muntoni F., Popplewell L, & Morgan J. (2022). Optimized lentiviral vector to restore full-length dystrophin via a cell-mediated approach in a mouse model of Duchenne muscular dystrophy. Molecular Therapy. Methods & Clinical Development, 25, 491-507.

+ Open protocol

+ Expand

Quantitative RT-PCR Analysis of CRISPR-Activated T Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

T cells were prepared as described under the “Arrayed CRISPRa experiments” section. Seven days after sgRNA transduction, 100,000 T cells per well were pelleted at 500g for 5 min at 4°C. Cells were lysed and RNA was extracted using the Quick-RNA 96 kit (Zymo Research) following the manufacturer’s protocol but skipping the option of in-well DNase treatment. DNase treatment and cDNA synthesis were subsequently completed with Maxima First Strand cDNA Synthesis Kit for reverse transcription quantitative PCR (RT-qPCR) with double-stranded DNase (Thermo Fisher Scientific). qPCR was performed with the PrimeTime PCR Master Mix (Integrated DNA Technologies) and PrimeTime qPCR probe assays (Integrated DNA Technologies; a list of probes used is provided in table S5) on an Applied Biosystems Quantstudio 5 real-time PCR system. Data were analyzed using the ΔΔCt method. The mean Ct values of two housekeeping genes, PPIA and GUSB, to calculate the ΔCt, and the mean ΔCt of nontargeting controls to calculate ΔΔCt.

Schmidt R., Steinhart Z., Layeghi M., Freimer J.W., Bueno R., Nguyen V.Q., Blaeschke F., Ye C.J, & Marson A. (2022). CRISPR activation and interference screens decode stimulation responses in primary human T cells. Science (New York, N.Y.), 375(6580), eabj4008.

+ Open protocol

+ Expand

Droplet Digital PCR for Quantitative Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated from freshly microdissected embryonic 15.5 cortices using Trizol and RNA Clean & Concentrator Kit. 600 ng of RNA was used as input for cDNA synthesis using SuperScript III (Invitrogen). Diluted cDNA was used for expression level analysis using ddPCR (QX200 Droplet Digital PCR System, Bio-Rad). Probe sets (PrimeTime qPCR Probe Assays) were purchased from Integrated DNA Technologies. For ddPCR, the reaction mixture was prepared with template cDNA, 2XddPCR Supermix (No dUTP) (Bio-Rad), target probes with HEX fluorescence, and control probe against house-keeping gene Srp72 with FAM fluorescence. Oil droplets were generated with the QX200 droplet generator (Bio-Rad) and transferred to the C1000 Touch Thermal cycler (Bio-Rad) for thermocycling. Following PCR amplification, the droplets were analyzed in the QX200 droplet reader (Bio-Rad), which analyzed each droplet individually using a two-color detection system.

Shi L., Qalieh A., Lam M.M., Keil J.M, & Kwan K.Y. (2019). Robust elimination of genome-damaged cells safeguards against brain somatic aneuploidy following Knl1 deletion. Nature Communications, 10, 2588.

+ Open protocol

+ Expand

Quantitative RT-PCR Analysis of Neural Markers

Check if the same lab product or an alternative is used in the 5 most similar protocols

For qRT-PCR, equal concentration of RNA was combined with TaqMan Fast Virus 1-Step Master Mix (Life Technologies) and PrimeTime qPCR Probe Assays (Integrated DNA Technologies). The reactions were performed using the QuantStudio 3 Real Time-PCR System (Applied Biosystems). Following probe sets were used; NeuN or Rbfox3 (Mm.PT.58.11398454), vGlut1 (Mm.PT.58.12116555) Aqp4 (Mm.PT.58.9080805), Mbp (Mm.PT.58.28532164), P2ry12 (Mm.PT.58.43542033), Syn1 (Mm.PT.58.32922616), Syp (Mm.PT.58.29275406), Camk2a (Mm.PT.58.8246010), Tubb3 (Mm.PT.58.32393592), Actb (Mm.PT.51.14022423).

Liakath-Ali K, & Südhof T.C. (2021). The Perils of Navigating Activity-Dependent Alternative Splicing of Neurexins. Frontiers in Molecular Neuroscience, 14, 659681.

+ Open protocol

+ Expand

Quantifying PAL Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

For determination of PAL differential gene expression for both the inhibitor experiments (Section 2.2) and the experiments with transgenic cell lines (Section 2.7), total RNA was extracted using a Quick-RNA Plant Kit (Zymo Research). Cell samples were homogenized using a Bullet Blender as previously described in Section 2.5, following which RNA extraction was performed according to manufacturer’s instructions. Immediately following RNA extraction, cDNA was synthesized using approximately 1 μg of total RNA using the ProtoScript II First Strand cDNA Synthesis Kit (New England Biolabs). Expression of PAL was then quantified using an Applied Biosystems 7500 Real-Time PCR System (Thermo Fisher). PrimeTime qPCR Probe Assays (Integrated DNA Technologies) were designed for the PAL gene as well as the housekeeping gene (actin) using the IDT PrimerQuest design tool (Supplementary Table S1). HEX/ZEN/Iowa Black FQ probes were used for the housekeeping gene and FAM/ZEN/Iowa Black FQ probes were used for PAL, to enable in-well multiplexing. The log₂fold change in expression of PAL relative to the respective control for each experiment was calculated using the double delta C_t method.

Brzycki Newton C., Young E.M, & Roberts S.C. (2023). Targeted control of supporting pathways in paclitaxel biosynthesis with CRISPR-guided methylation. Frontiers in Bioengineering and Biotechnology, 11, 1272811.

+ Open protocol

+ Expand

qRT-PCR Profiling of Neurexin Genes

Check if the same lab product or an alternative is used in the 5 most similar protocols

For qRT-PCR experiments, RNA concentration was measured using a NanoDrop 1000 Spectrophotometer (Thermo Fisher Scientific), and 8 ng total RNA was used per reaction. Transcripts were probed using PrimeTime qPCR Probe Assays (Integrated DNA Technologies), which consist of two primers and one FAM-labeled, ZEN/IBFQ-quenched 5′ nuclease probe. The following predesigned assays were used (gene, assay ID): Actb (Mm.PT.51.14022423), Arc (Mm.PT.58.5865502.g), Car10 (Mm.PT.58.11765793), Car11 (Mm.PT.58.32895602), Fam19a1 (Mm.PT.56a.6079538), Fam19a2 (Mm.PT.58.7298614), Fam19a4 (Mm.PT.56a.9330679), Fam19a5 (Mm.PT.56a.8916996), Fos (Mm.PT.58.29977214), and Gapdh (4352932E, Applied Biosystems). Additionally, the following assays were used (gene, primer 1, primer 2, probe): Nrxn1αβγ, 5′-CGATGTCATCTGTCCCAACA-3′, 5′-GCCATCGGATTTAGCACTGTC-3′, 5′-TGGAGCTGCACATACACCAAGGAA-3′; Nrxn2αβ, 5′-TGATATTTGCCGTCGCTCAC-3′, 5′-GGTGCGAGTGGACAGTG-3′, 5′-TCAATTGTAATGTCGTCCGTGCCCA-3′; and Nrxn3αβ, 5′-CACTGATAATGAACGCCTCCA-3′, 5′-CCTTTGTCCTTTCCTCCGATG-3′, 5′-CCTTTTTCCTGCAGCCACTCCTCT-3′. Assays generating threshold cycle (C_t) values >35 were omitted. C_t values for technical replicates differed by less than 0.5. C_t values were averaged for technical replicates.

Khalaj A.J., Sterky F.H., Sclip A., Schwenk J., Brunger A.T., Fakler B, & Südhof T.C. (2020). Deorphanizing FAM19A proteins as pan-neurexin ligands with an unusual biosynthetic binding mechanism. The Journal of Cell Biology, 219(9), e202004164.

+ Open protocol

+ Expand

RNA Extraction and Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Cells were seeded at 1 × 10⁵ cells/well in 24-well plates (Thermo Fisher Scientific). After the 2-day subculture, total RNA was extracted using the RNeasy kit (QIAGEN, Hilden, Germany) and was converted into cDNA using a ReverTra Ace qPCR RT Master Mix (TOYOBO). The cDNA was amplified by LightCycler 480 (Roche Diagnostics, Basel, Switzerland) using THUNDERBIRD Probe qPCR Mix (TOYOBO). Each sample was analyzed in triplicate in separate wells for the target and reference (18S rRNA) genes using the PrimeTime qPCR Probe Assays (Integrated DNA Technologies, Coralville, IA, USA). The average of three threshold cycle values for the target and reference genes was calculated and analyzed using the comparative Ct method.

Hamada T., Yokoyama S., Akahane T., Matsuo K, & Tanimoto A. (2022). Genome Editing Using Cas9 Ribonucleoprotein Is Effective for Introducing PDGFRA Variant in Cultured Human Glioblastoma Cell Lines. International Journal of Molecular Sciences, 24(1), 500.

+ Open protocol

+ Expand

Gene Expression Analysis of Metabolic Regulators

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA was extracted and purified with Direct-zol RNA kits from Zymo Research. 0.5 μg of RNA was subjected to reverse transcription using iScript Reverse Transcription Supermix from BIO-RAD. The products were tested for gene expression using PrimeTime qPCR Probe Assays from Integrated DNA Technologies (Mm.PT.58.7590689 for Slc2a1, Mm.PT.58.30464830 for Slc2a3, Mm.PT.58.8951520 for Rpl7, Hs.PT.39a.22214824 for RPLP0, Hs.PT.56a.27441991 for CD27, Hs.PT.58.19831504 for TCF7 and Hs.PT.58.25872862 for SLC2A1). Quantitative results were normalized to mouse Rpl7 or human RPLP0 expression.

Mo F., Yu Z., Li P., Oh J., Spolski R., Zhao L., Glassman C.R., Yamamoto T.N., Chen Y., Golebiowski F.M., Hermans D., Majri S.S., Picton L.K., Liao W., Ren M., Zhuang X., Mitra S., Lin J.X., Gattinoni L., Powell J.D., Restifo N.P., Garcia K.C, & Leonard W.J. (2021). An engineered IL-2 partial agonist promotes CD8+ T cell stemness. Nature, 597(7877), 544-548.

+ Open protocol

+ Expand

Quantitative Real-Time PCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

cDNA was synthesized using random hexamers and RT² First Strand Kit (Qiagen) and the RNA used was the same as in the RNA-seq experiment. Subsequent real time PCR was performed using PrimeTime qPCR Probe Assays (Integrated DNA Technologies). Primer sequences are depicted in Supplementary Table S8, and reaction conditions are available upon request. Three genes used for normalization were selected based on the highest expression stability in the RNA-seq experiment. PCR was performed in technical triplicates for genes of interest and duplicates for normalization genes on a LightCycler 480 Instrument II (Roche). Data quantities were determined using absolute quantitation.

Ballonová L., Souček P., Slanina P., Réblová K., Zapletal O., Vlková M., Hakl R., Bíly V., Grombiříková H., Svobodová E., Kulíšková P., Štíchová J., Sobotková M., Zachová R., Hanzlíková J., Vachová M., Králíčková P., Krčmová I., Jeseňák M, & Freiberger T. (2023). Myeloid lineage cells evince distinct steady-state level of certain gene groups in dependence on hereditary angioedema severity. Frontiers in Genetics, 14, 1123914.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!