A cassette containing the small hairpin (sh) RNA under the control of H1 RNA polymerase III promoter or the muSEAP transgene under CMV promoter has been inserted in a pSMD2 expression plasmid. AAV vectors (serotype 1) were produced in HEK293 cells after transfection of the pSMD2‐shRNA or ‐muSeap plasmids or empty pSMD2 plasmid, the pXX6 plasmid coding for viral helper genes essential for AAV production and the pRepCap plasmid (p0001) coding for AAV1 capsid as described previously (Riviere et al, 2006 ). Viral particles were purified on iodixanol gradients and concentrated on Amicon Ultra‐15 100K columns (Merck‐Millipore). The concentration of viral genomes (vg/ml) was determined by quantitative real‐time PCR on a LightCycler480 (Roche diagnostic, France) by using TaqMan probe. A control pSMD2 plasmid was 10‐fold serially diluted (from 107 to 101 copies) and used as a control to establish the standard curve for absolute quantification. Sequences of primers and probes are indicated in Appendix Table S2 .
Amicon ultra 15 100k columns
Manufactured by Merck Group
Sourced in United States
The Amicon Ultra-15 100K columns are centrifugal filter devices used for the concentration and desalting of protein samples. The columns have a 100 kDa molecular weight cut-off and are designed for rapid sample preparation prior to further analysis or experimentation.
Automatically generated - may contain errors
Lab products found in correlation
Lightcycler 480, by Roche (1 mentions)
Taqman mgb probe, by Thermo Fisher Scientific (1 mentions)
Phusion polymerase, by Thermo Fisher Scientific (1 mentions)
Steponeplus, by Thermo Fisher Scientific (1 mentions)
Paddeltaf6, by Addgene (1 mentions)
Optiprep, by Merck Group (1 mentions)
Ssoadvance universal sybr green supermix, by Bio-Rad (1 mentions)
Pei max 40k, by Polysciences (1 mentions)
5 protocols using amicon ultra 15 100k columns
1
Production and Quantification of AAV Vectors
2
Production and Purification of AAV Vectors
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
AAV2/1 pseudotyped vectors were prepared by transfection in 293 cells as described previously (Rivière et al., 2006 (link)) using the pSMD2-shRNA plasmid, the pXX6 plasmid (Généthon) coding for the adenoviral sequences essential for AAV production, and the pRepCAp plasmid (Généthon) coding for AAV1 capsid. Vector particles were purified on iodixanol gradients and concentrated on Amicon Ultra-15 100K columns (EMD Millipore). The final viral preparations were kept in PBS solution at −80°C. The particle titer (number of viral genomes) was determined by quantitative PCR. Titers for AAV shCHC were 4 × 1012 vector genomes (vg)/ml.
3
AAV9-Mediated Expression of AP2-mCherry
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
An AAV serotype 9 was produced for expression of the µ2-subunit of the AP2 clathrin adaptor tagged with mCherry (AP2-mCherry) (Taylor et al., 2011 (link)). AAV2/9 pseudotyped vectors were prepared by tri-transfection in 293 cells as described previously (Rivière et al., 2006 (link)) using the pSMD2-AP2-mCherry plasmid, pXX6 plasmid coding for the viral sequences essential for AAV production, and the pRepCap plasmid coding for serotype 9 capsid. Vector particles were purified on iodixanol gradient and concentrated on Amicon Ultra-15 100K columns (Merck-Millipore, USA). The viral genomes titer (vg/ml) was determined by quantitative real-time PCR. WT and HTZ KI-Dnm2R465W mice were injected at 6 mo of age. One intramuscular injection (40 µl/TA) of AAV9-AP2-mCherry at 6.1011 vg/ml was performed in TA muscles using a 29G needle.
4
Mutated pAAV-mSEAP Construct Production
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The pAAV-mSEAP construct was mutated in both D sequences (mutpAAV-mSEAP). Briefly, blunt amplicons were obtained by PCR using Phusion polymerase (Thermo Scientific) with the 5′-phosphorylated mutAAV primer ccaactccatcactagAggttccttgtag (with A introducing the T mutation in the D sequence) matching on both D sequences of pAAV-mSEAP plasmid, and cloned in pAAV in MscI restriction sites.
AAV2/1 pseudotyped vectors were prepared by transfection in HEK-293 cells as described previously54 (link) using the pAAV-mSEAP or the mutpAAV-mSEAP plasmids with the pXX6 plasmid coding for the Ad helper genes essential for AAV production and the pRepCap plasmid (p0001) coding for AAV1 capsid. Vector particles were purified on iodixanol gradient and concentrated on Amicon Ultra-15 100 K columns (Merck-Millipore). The particle titer corresponding to the number of viral genomes per milliliter (vg/ml) was determined by quantitative real-time PCR on a StepOnePlus (Applied Biosystems), by using the following primers and probe: CTCCATCACTAGGGGTTCCTTG (forward), GTAGATAAGTAGCATGGC (reverse) and TAGTTAATGATTAACCC (Taqman MGB probe, Life Technologies). The pAAV plasmid was used as a control to establish the standard curve for absolute quantification.
AAV2/1 pseudotyped vectors were prepared by transfection in HEK-293 cells as described previously54 (link) using the pAAV-mSEAP or the mutpAAV-mSEAP plasmids with the pXX6 plasmid coding for the Ad helper genes essential for AAV production and the pRepCap plasmid (p0001) coding for AAV1 capsid. Vector particles were purified on iodixanol gradient and concentrated on Amicon Ultra-15 100 K columns (Merck-Millipore). The particle titer corresponding to the number of viral genomes per milliliter (vg/ml) was determined by quantitative real-time PCR on a StepOnePlus (Applied Biosystems), by using the following primers and probe: CTCCATCACTAGGGGTTCCTTG (forward), GTAGATAAGTAGCATGGC (reverse) and TAGTTAATGATTAACCC (Taqman MGB probe, Life Technologies). The pAAV plasmid was used as a control to establish the standard curve for absolute quantification.
5
AAV Production and Characterization
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Lenti-X Hek293T cells cultured in DMEM supplemented with 10% FCS, 1% Penicillin/Streptomycin and 1% Sodiumpyruvate were transfected with 0.5 mg of pAAV.CAG.GCaMP6s.WPRE.SV40 (Addgene, #100844), pAAV2.7 (Addgene, #112863) and pAdDeltaF6 (Addgene, #112867) plasmids each by PEI transfection method (PEI Max 40K, Polysciences, #24765). 5 days after transfection cells were harvested, pelleted, resuspended in lysis buffer (150 mM NaCl, 20 mM Tris) and lysed using repeated freeze thaw cycles (3x, 15 min 37°C, 15 min dry ice). MgCl2 and Benzonase (Molecular Biology Facility, IMP Vienna) was added to the cell lysates in a final concentration of 1 mM and 250U/ml respectively and incubated for 15 min at 37°C before dounce homogenization. Viral particles were then purified using Iodixanol gradient (Optiprep, Sigma-Aldrich, #D1556) centrifugation at 62000 rpm for 140 min. Virus was collected from the 40% Iodixanol fraction and concentrated by centrifugation (30 min, 3500 rpm) using Amicon Ultra-15 100K columns (Merck, #UFC910008). Viral titer was determined by qPCR using a Bio-Rad CFX Connect cycler (Bio-Rad, Hercules, CA, USA, 1855201) and SsoAdvance Universal SYBR Green Supermix (Bio-Rad, #1725271) (primers: GCaMP6s_1_F ATGAAATACAGGGACACGGAAGAA; GCaMP6s_1_R ACTTCTCTCCAAGGTTTGTCATCA).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!