Hek293t

Manufactured by Addgene

Sourced in United States

HEK293T is a type of cell line derived from human embryonic kidney cells. It is commonly used in research and laboratory settings as a host for the production and expression of recombinant proteins.

Automatically generated - may contain errors

Lab products found in correlation

Spelling variants of this product

HEK293T cells (20 citations)

12 protocols using hek293t

Cell Line Authentication and Culture Protocols

Check if the same lab product or an alternative is used in the 5 most similar protocols

All cell lines were authenticated by the University of Arizona Genetics Core using PowerPlex 16HS Assay (Promega) with > 80% match to eight core STR loci [46 (link)], with the exception of LNCaP, which was obtained from ATCC immediately prior to use. Cell lines were cultured according to ATCC recommendations as follows; RWPE (RWPE-1) and RWPE-KRAS (RWPE-2): Keratinocyte SFM (Invitrogen), LNCaP and CWR22Rv1: RPMI 1640 (Mediatech-Cellgro) with 10% fetal bovine serum (FBS) [Sigma], PC3: F12K medium (Mediatech-Cellgro) with 10% FBS. 293 EBNA, HEK-293 T, DU145 and VCaP: Dulbecco’s modification Eagle (DMEM) [Sigma] with 10% FBS, MDA-PCa-2b: BRFF-HPC1 (Athena Enzyme Systems) with 20% FBS. All media were supplemented with 1% Penicillin/Streptomycin (Mediatech-Cellgro).
ETS proteins with N-terminal 3xFlag tags were stably expressed in RWPE via retrovirus as described previously [15 (link)]. Plasmids for lentiviral shRNA knockdowns were obtained from AddGene, mTOR (#1855), Raptor (#1857) and Rictor (#1853), are from Sarbassov et al.[33 (link)]. Lentivirus was produced by co-transfection of pLKO.1 constructs in HEK293T cells with pMDLg/pRRE, pRSV-Rev and pMD2.G envelope plasmids from Dull et al.[47 (link)] and AddGene.

Selvaraj N., Budka J.A., Ferris M.W., Jerde T.J, & Hollenhorst P.C. (2014). Prostate cancer ETS rearrangements switch a cell migration gene expression program from RAS/ERK to PI3K/AKT regulation. Molecular Cancer, 13, 61.

+ Open protocol

+ Expand

Comparison of Cell Lines for SARS-CoV-2 Studies

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Calu-3 (cat. HTB-55), Vero E6 (cat. CRL-1586), HEK293 (cat. CRL-1573) and HEK293T (cat. CRL-3216) cells were purchased from ATCC. Calu-3 cells were grown in Eagle's minimum essential medium (EMEM) (Wisent, cat. 320–005-CL) supplemented with 15% fetal bovine serum (FBS) (Gibco, cat. 12,483–020). Vero E6 and HEK293T cells were grown in Dulbecco's modified Eagle medium (DMEM) supplemented with 10% FBS. Vero E6/TMPRSS2 cell line was generated by transducing Vero E6 cells with lentiviral particles expressing human TMPRSS2, followed by selection with 1 mg/ml G418 (Wisent, cat. 400–130-IG). HEK293/ACE2/TMPRSS2 cells were generated by sequential transduction of HEK293 cells with lentiviral particles expressing human ACE2 (selection with 2 μg/ml puromycin) and lentiviral particles expressing human TMPRSS2 (selection with 1 mg/ml G418). The TMPRSS2 (cat. 145,843) and ACE2 (cat. 145,839) lentiviral DNA clones (Rebendenne et al., 2021 ) were purchased from Addgene and transfected into HEK293T cells together with pSPAX2 (Addgene, cat. 12,260) and VSV-G DNA (Addgene, cat. 8454) (Stewart et al., 2003 (link)) to produce lentiviral particles. Virus HCoV-229E-Luc was kindly provided by Volker Thiel (van den Worm et al., 2012 (link)). Sendai virus (Cantel Strain) was obtained from Charles River Laboratories (Sze et al., 2017 ).

Wang Z., Pan Q., Ma L., Zhao J., McIntosh F., Liu Z., Ding S., Lin R., Cen S., Finzi A, & Liang C. (2023). Anthracyclines inhibit SARS-CoV-2 infection. Virus Research, 334, 199164.

+ Open protocol

+ Expand

Lentiviral Transduction of Cell Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols

Cervical carcinoma cell lines Hela, breast carcinoma cell lines MDA-MB-231, and HEK293T were purchased from American Type Culture Collection (ATCC; Manassas, USA). Cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM; Invitrogen, Carlsbad, USA) or RPMI-1640, supplemented with 10% FBS (Gibco, Carlsbad, USA), 100 units/mL penicillin, and 100 μg/mL streptomycin (Gibco). Lentiviral vector pLKO.1 (Addgene, Watertown, USA) whose backbone with GFP was allowed the ectopic expression of scramble shRNA (5′-TCCTAAGGTTAAGTCGCCCTCG-3′; Sangon Biotech, Shanghai, China) or AHNAK2 shRNA (Sh#1-
h-
AHNAK2-F 5′-CCGGGGTGCGAGTACACGATTTAAACTCGAGTTTAAATCG TGTACTCGCACCTTTTTG-3′, Sh#1-
h-
AHNAK2-R 5′-AATTCAAAAAGGTGCGAGTACACGATTTAAACTCGAGTTTAAATCGTGTACT CGCCC-3′; and Sh#2-
h-
AHNAK2-F 5′-CCGGACGCACAGAGGAAGGATTAAACTCGAGTTTAATCCTTCCTCTGTGCGTTTTTTG-3′, Sh#2-
h-
AHNAK2-R 5′-AATTCAAAAAACGCACAGAGGAAGGATTAAACTCGAGTTTAATCCTTCCTCTGTGCGT-3′; Sangon Biotech), vesicular stomatitis virus G (Addgene), and packaging plasmid Delta 8.9 (Addgene) were co-transfected into HEK293T cells through conventional calcium phosphate method to produce lentivirus. GFP
⁺ cells were selected with BD Accuri C6 Flow cytometer (Franklin Lakes, USA).

Xu M., Cheng A., Yu L., Wei W., Li J, & Cai C. (2022). AHNAK2 is a biomarker and a potential therapeutic target of adenocarcinomas: AHNAK2 is a biomarker for adenocarcinomas. Acta Biochimica et Biophysica Sinica, 54(11), 1708-1719.

+ Open protocol

+ Expand

Lentivirus Production Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

Human HCC cell lines Huh7 (SCSP-526), HepG2 (SCSP-510), SMCC-7721 (TCHu 52) and embryo kidney cell line HEK293T (SCSP-502) were obtained from Cell Bank of Shanghai Institutes of Biological Sciences, Chinese Academy of Sciences (Shanghai, China). These cells were maintained in Dulbecco’s modified Eagle medium (DMEM, Gibco, USA) supplemented with 100 U/ml penicillin G/streptomycin sulfate and 10% (v/v) foetal bovine serum (FBS, Gibco, USA), and cultured at 37 °C with 5% CO₂.
Helper plasmids pSPAX2 (Addgene plasmid 12260) and pMD2.G (Addgene plasmid 12259) were co-transfected with pLKO.1- or pWPI.1-based plasmids into HEK293T cells to package recombinant lentiviruses. Supernatants from co-transfections were used for infection of cultured cells.

Wang Y., Luo M., Wang F., Tong Y., Li L., Shu Y., Qiao K., Zhang L., Yan G., Liu J., Ji H., Xie Y., Zhang Y., Gao W.Q, & Liu Y. (2022). AMPK induces degradation of the transcriptional repressor PROX1 impairing branched amino acid metabolism and tumourigenesis. Nature Communications, 13, 7215.

+ Open protocol

+ Expand

Establishment of Stable Knockout/Knockdown Cell Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols

Human umbilical vein endothelial cell line (HUVECs) was obtained from the American Type Culture Collection (Rockville, MD, USA). Human embryonic kidney cell line (HEK293T) was obtained from the National Collection of Authenticated Cell Cultures (Shanghai, China). All cells were cultured within the DMEM that contained the 10% FBS and penicillin–streptomycin antibiotics (100 U/ml) at 37 °C with 5% CO₂. Stable knockout/knockdown cell lines were constructed using LentiCRISPRv2 plasmid (Cat#52961, Addgene, Watertown, MA, USA). The recombinant plasmids lentiCRISPRv2-sgNRF2, lentiCRISPRv2-sgATG5, LentiCRISPRv2-sgKEAP1 plasmid were constructed in our laboratory and sequenced at Sangon Biotech (Shanghai, China). Then these sequenced plasmids were co-transfected with psPAX2 (Cat#12260, Addgene) and pMD2.G (Cat#12259, Addgene) into HEK293T cells for lentiviral packaging. The HUVECs was infected with lentivirus for 48 h and then subjected to two rounds of puromycin selection to obtain stable cell lines. For CuONPs in vitro treatment, CuONPs was firstly diluted in sterilized water at dose of 2 mg/ml and ultrasonicated in a water bath for 30 min. Then, the cells seeded in 12-well plate were treated with different concentration of CuONPs for indicated time points.

Li N., Du H., Mao L., Xu G., Zhang M., Fan Y., Dong X., Zheng L., Wang B., Qin X., Jiang X., Chen C., Zou Z, & Zhang J. (2022). Reciprocal regulation of NRF2 by autophagy and ubiquitin–proteasome modulates vascular endothelial injury induced by copper oxide nanoparticles. Journal of Nanobiotechnology, 20, 270.

+ Open protocol

+ Expand

Optimized Viral Transduction for Cell Line Studies

Check if the same lab product or an alternative is used in the 5 most similar protocols

All cell lines were obtained from American Type Culture Collection. A549 and PC9 cells were cultured in RPMI supplemented with 5% Fetal Bovine Serum (FBS, HyClone) and 100 U ml⁻¹ penicillin and 100 μg ml⁻¹ streptomycin (Gibco) at 37 °C with 5% CO₂ incubation. MEFs and Hek-293T cells were maintained in Dulbecco's Modified Eagles Medium (DMEM) with 10% FBS and antibiotics. Virus packaging was achieved by transiently co-transfecting Hek-293T cells on 10 cm culture dish with 3 μg of the construct encoding the genes of interest and sgRNA along with 6 μg of the packaging plasmid psPAX2 and 3 μg of the envelope plasmid pMD2.G (Addgene) using 30 μl of the Lipofectamine 2000 reagent (Life Technologies). Viral particles of10 ml were collected after 48 h of transfection by clarifying the supernatant through 0.45 μm filter membrane (GE Healthcare). Virus transduction was optimized in order to achieve low MOI transduction. Typically, 500 μl fresh virus particles from 10 ml stock were used to infect 1 × 10⁶ cells on a 10 cm culture dish in 10 ml total volume of culture medium. Virus aliquots were stored at −80 °C. Shield-1, obtained from Cheminpharma, was solubilized in pure ethanol, and was added to culture media with given concentrations.

Senturk S., Shirole N.H., Nowak D.G., Corbo V., Pal D., Vaughan A., Tuveson D.A., Trotman L.C., Kinney J.B, & Sordella R. (2017). Rapid and tunable method to temporally control gene editing based on conditional Cas9 stabilization. Nature Communications, 8, 14370.

+ Open protocol

+ Expand

Generating Doxycycline-Inducible Cas9 HEK293T Cell Line

Check if the same lab product or an alternative is used in the 5 most similar protocols

HEK293T cell line was purchased from ATCC (CRL-3216) and cultured in DMEM medium (Gibco) supplemented with 10% FBS (Sigma) and 1% penicillin-streptomycin (Gibco) at 37 °C with 5% CO₂. A monoclonal HEK293T cell line expressing doxycycline-inducible Cas9 (HEK293T-iCas9) was generated by infecting parental cells with pCW-Cas9 (Addgene plasmid #50661) lentivirus. All the cell lines were routinely tested for being free of mycoplasma contamination using MycoAlert™ Mycoplasma Detection Kit (Lonza #LT07-218).

Fu R., He W., Dou J., Villarreal O.D., Bedford E., Wang H., Hou C., Zhang L., Wang Y., Ma D., Chen Y., Gao X., Depken M, & Xu H. (2022). Systematic decomposition of sequence determinants governing CRISPR/Cas9 specificity. Nature Communications, 13, 474.

+ Open protocol

+ Expand

Establishment and Characterization of Stable Cell Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols

Hepatocellular carcinoma cell lines HepG2, PLC, SK-Hep1, colorectal cancer cell line SW480 and lentivirus packaging cell HEK293T were obtained from American Type Culture Collection (ATCC) and maintained in Dulbecco’s Modified Eagle Medium (DMEM, Gibco, 11995065) containing 10% fetal bovine serum (Gibco) and 1% penicillin–streptomycin (Invitrogen). In this study, for establishing stable cell lines with ELECTS, ELECTS and SB100X (Addgene #34879) plasmids (10:1) were co-transfected into HepG2 and SK-Hep1 cells using lipid nanoparticle Lipofectamine 3000 (Thermo Fisher #L3000015), and the cells were selected by puromycin for ~ 5 days. Transmission electron microscopy (TEM) was conducted. Zeta potential and physicochemical properties of nanomaterials were determined by dynamic light scattering (DLS) with a Malvern Zetasizer, NANO ZS (Malvern Instruments Limited, UK). For the lentiviral vector, pCDH plasmids were co-transfected into HEK293T cell with the packaging plasmids psPAX2 (Addgene #12260) and pMD2.G (Addgene #12259) using polyethylenimine transfection reagent (Polysciences, #23966). Viral particle supernatants were harvested and concentrated using 44% PEG8000 (Sigma-Aldrich, #89510) and 4 M NaCl. HepG2 and SK-Hep1 cells were infected with the lentiviruses in the presence of 5 ug/mL Polybrene (Yeasen, #40804ES76) and selected by puromycin for 5–7 days.

Zhang Y., Huang Y.X., Jin X., Chen J., Peng L., Wang D.L., Li Y., Yao X.Y., Liao J.Y., He J.H., Hu K., Lu D., Guo Y, & Yin D. (2021). Overexpression of lncRNAs with endogenous lengths and functions using a lncRNA delivery system based on transposon. Journal of Nanobiotechnology, 19, 303.

+ Open protocol

+ Expand

Establishment of HEK293T-ACE2 Cell Line

Check if the same lab product or an alternative is used in the 5 most similar protocols

HEK293T cells were from the American Type Culture Collection (ATCC, Cat. CRL-3216) and cultured in 10% fetal bovine serum (FBS, HyClone, Cat. SH3008403)-supplemented Dulbecco’s modified Eagle’s medium (DMEM, HyClone, Cat. SH30243.01) at 37°C and with 5% CO₂. HEK293T-ACE2 cells were established via infection of VSV G-pseudotyped lentivirus packaging human ACE2 encoded by pWPI-IRES-Puro-Ak-ACE2 [Addgene, Cat. 154985, kindly provided by Inchan Kwon (Gwangju Institute Science and Technology)]. Pseudotype production was performed as described in the Method Details below. The ACE2 expression level was maintained under 10 μg/ml puromycin. ACE2 expression was confirmed through surface staining (R&D Systems, Cat. FAB933A-100) and inhibition assay by soluble ACE2 protein (In vivogen, Cat. fc-hace2).

Sim K.Y., Ko G.H., Bae S.E., Choi K.Y., Lee J.S., Kim B.C., Lee K.H., Song M.R, & Park S.G. (2022). Two Opposing Roles of SARS-CoV-2 RBD-Reactive Antibodies in Pre-Pandemic Plasma Samples From Elderly People in ACE2-Mediated Pseudovirus Infection. Frontiers in Immunology, 12, 813240.

+ Open protocol

+ Expand

Generating Stable Cas9-Expressing Cell Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols

Cas9‐mCherry (Addgene Plasmid #70182) was used to generate stable Cas9‐expressing cell lines. sgRNA sequences listed in Dataset EV5 were cloned into the lentiGuide‐Crimson backbone (Addgene Plasmid # 70683). Nonreplicating lentiviruses were generated by transient co‐transfection of the transfer plasmids into HEK293T together with the packaging plasmids pMDL (Addgene Plasmid #12251), pRSV‐REV (Addgene Plasmid #12253), and pVSVG (Addgene Plasmid #12259). Lentivirus containing supernatants were harvested and transduced into AML cell lines with 4 µg/ml sequabrene (Sigma‐Aldrich).

So J., Lewis A.C., Smith L.K., Stanley K., Franich R., Yoannidis D., Pijpers L., Dominguez P., Hogg S.J., Vervoort S.J., Brown F.C., Johnstone R.W., McDonald G., Ulanet D.B., Murtie J., Gruber E, & Kats L.M. (2022). Inhibition of pyrimidine biosynthesis targets protein translation in acute myeloid leukemia. EMBO Molecular Medicine, 14(7), e15203.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!