Tumor cells cultured in 15 cm dish were washed with PBS and lysed in 1 mL of 1% Triton X-100 after treatment with compounds. After 15 min centrifuging at 12,000 rpm (MicroCL 17R, Thermo Fisher, Waltham, MA, USA) at 4 °C, 500 μL of the supernatant of each sample was mixed with equal volume of sodium acetate buffer (pH 4.6) and 100 μL of ethyl acetoacetate, and heated at 100 °C for 10 min. After cooling, 200 μL of ethyl acetate was added and mixed thoroughly, later layered by centrifuging at 12,000 rpm (MicroCL 17R, Thermo Fisher, Waltham, MA, USA) for 5 min. 100 μL of the upper layer was transferred to react with Ehrlich reagent and was determined colorimetrically at 553 nm. Ehrlic reagent was prepared as follows: 1 g of DMAB is dissolved in 30 mL of glacial acetic acid, then 5 mL of 70% perchloric acid are added, followed by 5 mL H2O and the solution is diluted to 50 mL with glacial acetic acid41 (link). This reagent should be used freshly since it is unstable.
Microcl 17r
Manufactured by Thermo Fisher Scientific
Sourced in United States, Germany
The MicroCL 17R is a compact, high-performance benchtop centrifuge designed for general-purpose laboratory applications. It features a maximum speed of 17,000 rpm and a maximum relative centrifugal force (RCF) of 24,600 x g. The centrifuge accommodates a variety of rotor types, including fixed-angle and swing-out rotors, to support a wide range of sample volumes and tube sizes.
Automatically generated - may contain errors
Lab products found in correlation
Bovine serum albumin (bsa), by Merck Group (1 mentions)
Potassium ferricyanide k3 fe cn 6, by Merck Group (1 mentions)
Protease and phosphatase inhibitor cocktail, by Merck Group (1 mentions)
Synergy 2 multi detection microplate reader, by Agilent Technologies (1 mentions)
Quinacrine dihydrochloride, by Merck Group (1 mentions)
Atp bioluminescence assay kit hs 2, by Roche (1 mentions)
Elx800, by Agilent Technologies (1 mentions)
Avance 500 spectrometer, by Bruker (1 mentions)
Triethylene glycol, by Merck Group (1 mentions)
Luminescence spectrometer, by PerkinElmer (1 mentions)
9 protocols using microcl 17r
1
Determination of acetoacetate in cells
2
Electrochemical Biosensor for ENaC Protein Detection
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
ENaC protein was obtained from Abcam, UK. ENaC aptamer (sequence: 5′–/5Biosg/CGGTGAGGGTCGGGTCCAGTAGGCCTACTGTTGAGTAGTGGGCTCC–3′) was obtained from DT Integrated DNA Technologies, US. Bovine serum albumin (BSA) and potassium ferricyanide (K3[Fe(CN)6]) were acquired from Sigma Aldrich. Sodium chloride (NaCl), sodium hydroxide (NaOH), phosphate buffer saline (PBS, pH 7.4) and cerium (III) nitrate hexahydrate (Ce(NO3)3 · 6H2O) were obtained from Merck. The double-distilled water was produced by PT Ikapharmindo Putramas, Indonesia.
Electrochemical measurements were performed by using a ZP potentiostat with the computer Interface of PSTrace 5.4 software (Zimmer & Peacock, UK). The SPCE (GS1 Technologies, USA) consisted of carbon working and counter electrodes as well as an Ag/AgCl reference electrode. In addition, other supporting equipment included an autoclave sterilizer (Hirayama Autoclave HVE-50), microtubes and micropipette tips (Eppendorf), magnetic stirrer, mini spin (Eppendorf), hot plate (IKA C-MAG HS 7) and centrifuge (Thermo Scientific MicroCL 17R, USA). The morphologies of the electrode surface were analysed by using scanning electron microscopy (SEM) (Hitachi, Japan).
Electrochemical measurements were performed by using a ZP potentiostat with the computer Interface of PST
3
Membrane Protein Extraction from Tissue
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Membrane protein extraction was performed on ice. The heart tissue or cells were homogenized in the lysis buffer (KPG350, KeyGEN, China) added with protease inhibitor and dithiothreitol. Then vortex mixing was done for 30 s and place on the ice for 1 min, repeated for 5 cycles. The lysate was centrifuged at 12,000 rpm (MicroCL 17R, Thermo Fisher Scientific) for 10 min. The pellets were collected and homogenized in an extraction buffer solution. Then vortex mixed for 30 s, and place on the ice for 5 min, 5 cycles. The lysate was centrifuged at 12,000 rpm for 10 min again, and the supernatant was collected as the membrane protein.
4
Western Blot Analysis of Protein Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
After treated with the compounds for the indicated times, cells were lysed by RIPA buffer (150 mmol/L NaCl, 1% NP-40, 0.5% sodium deoxycholate, 0.1% SDS, 50 mmol/L Tris-HCl, pH 7.5) containing protease and phosphatase inhibitor cocktail (Merck Millipore, Billerica, MA, USA) with freshly added 1 mmol/L of PMSF. After centrifugation at 12,000 rpm (MicroCL 17R, Thermo Fisher Scientific, Waltham, MA, USA) at 4 °C for 20 min, supernatants were collected and equal amounts of protein were subjected to Western blot assay as described before37 (link), 38 (link). After being visualized using an electrochemiluminescence kit (Sudgen, China), luminescence was assessed by chemiluminescent imaging system (Tanon, Shanghai, China).
5
Quantifying Intracellular ATP Dynamics
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Intracellular ATP was stained with the ATP-sensitive fluorochrome quinacrine [38 (link)]. Cells (5 × 104) were incubated with 10 μM quinacrine dihydrochloride (Sigma) in 100 μL PBS at 37 °C for 1 h. Then the cells were washed 4 time with PBS and resuspended in 100 μL for flow analysis. Fluorescence was detected by flow cytometer at 510–530 nm with excitation at 488 nm [39 (link)]. A decreased level of intracellular ATP reflects an increase of extracellular ATP release. To confirm it, we measured quantitatively extracellular released ATP by testing some of the collected cell culture supernatants (by centrifugation at 2000 rpm, 10 min, 4 °C, MICROCL 17R, Thermo Scientific) with ATP Bioluminescence Assay Kit HS II (Roche, Mannheim, Germany) per manufacturer’s instructions, with the Synergy 2 Multi-Detection Microplate Reader (BioTek, Winooski, USA).
6
Antioxidant Potential Evaluation Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The analysis was performed using the method described by Klompong et al. [32 (link)], based on the principle of increasing the absorption of reaction mixtures. The extract in the volume of 0.2 mL of each sample was mixed with 2 mL phosphate buffer (0.2 M, pH 6.6) and 5 mL 1% potassium hexacyanoferrate. After incubation at 50 °C, 1mL of 10% trichloroacetic acid was added for 20 min and after shaking, the solution was centrifuged for 10 min with a centrifuge (MicroCL 17R, Thermo, Germany) at 2000× g. The solution was then mixed with 1 mL of trichloroacetic acid for 20 min. The supernatant was mixed with 2 mL distilled water and 0.5 mL 0.1% ferric chloride. After incubation at room temperature, the optical density at 700 nm was measured with an SF-102 UV spectrophotometer for 10 min. The higher absorption indicates a higher regenerability. Ascorbic acid solution (1 mg/mL) was a positive control.
7
Plasma Insulin and Triglyceride Measurement
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The tail vein blood was collected for the measurement of fasting insulin and triglyceride levels. Plasma was obtained by centrifugation of blood samples at 900× g for 10 min at 4 °C with a centrifuge (MicroCL 17R, Thermo Fisher Scientific Inc., Waltham, MA, USA). The plasma level of insulin was determined by Enzyme-linked immunosorbent assay (Elisa) by using a kit (USCN Business Co., Ltd., Wuhan, China) referring to the manufacturer’s instructions. The triglyceride level was detected by colorimetric assay with a kit (Jiancheng Bioengineering, Nanjing, China) according to the manufacturer’s descriptions. The optical density at a certain wavelength was measured by a microplate reader (ELX800, BioTek, Winooski, VT, USA).
8
Centrifugation Effects on Serum Analytes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All analytes have first been measured in centrifugated serum samples according to the protocol of centrifugation of serum samples established by the laboratory which indicates the centrifugation of samples at 3000 rpm for 10 minutes. The centrifuge used was SL16 (Thermo Scientific, Waltham, USA).
Then, the same serum has been centrifugated at high-speed at 12,900 rpm for 15 minutes and the same biochemical analytes have been measured again. The centrifuge used for high-speed centrifugation was MicroCL 17R (Thermo Scientific, Waltham, USA).
Analytes measurements have been obtained using a Cobas 8000 automated analyser (Roche Diagnostics, Mannheim, Germany). The specific methods used for each analyte are shown inTable 1 .
Then, the same serum has been centrifugated at high-speed at 12,900 rpm for 15 minutes and the same biochemical analytes have been measured again. The centrifuge used for high-speed centrifugation was MicroCL 17R (Thermo Scientific, Waltham, USA).
Analytes measurements have been obtained using a Cobas 8000 automated analyser (Roche Diagnostics, Mannheim, Germany). The specific methods used for each analyte are shown in
9
Diclofenac-Loaded Functionalized Micelles
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Pure diclofenac powder gifted from Pharmacare Pharmaceutical Company, PEG 400, and PEG 600 were purchased from Sun Pharm Ltd. Triethylene glycol (TEG) was purchased from Merck Company. Lipopolysaccharide (LPS) from Escherichia coli, N,N-diisopropylethylamine (DIPEA), human Tumor Necrosis Factor α ELISA Kit, esterase from the porcine liver, 2-(1H-benzotriazole-1-yl)-1,1,3,3-tetramethylaminium tetrafluoroborate (TBTU), silica gel (230–400 mesh), and pyrene were supplied from Sigma-Aldrich company. Spectra/Por® 4 dialysis membrane (12–14 kDa MWCO) was used for in vitro release study.
Rotary evaporator (VV2000 OB2000, Heidolph, Germany) was used. Centrifuge (Micro CL 17R, Thermofischer Scientific, Germany), and water path sonicator (Elmasonic S 70 H, Elma®, Germany) were utilized in the preparation and dispersion of functionalized micelles. The Bruker Avance 500 spectrometer was used to record Nuclear Magnetic Resonance (NMR) spectra. Chemical shifts and coupling constants were applied in ppm, and Hz, respectively. UV/vis spectrophotometer (Jenway, UK) was utilized to record Ultraviolet-visible (UV-vis) spectrausing quartz cuvettes. Regarding the Atomic Force Microscopy (AFM) analysis, a tapping mode and Si3N4 cantilevers were used for the analysis. Fluorescence spectroscopy of Perkin Elmer Luminescence spectrometer was used.
Rotary evaporator (VV2000 OB2000, Heidolph, Germany) was used. Centrifuge (Micro CL 17R, Thermofischer Scientific, Germany), and water path sonicator (Elmasonic S 70 H, Elma®, Germany) were utilized in the preparation and dispersion of functionalized micelles. The Bruker Avance 500 spectrometer was used to record Nuclear Magnetic Resonance (NMR) spectra. Chemical shifts and coupling constants were applied in ppm, and Hz, respectively. UV/vis spectrophotometer (Jenway, UK) was utilized to record Ultraviolet-visible (UV-vis) spectrausing quartz cuvettes. Regarding the Atomic Force Microscopy (AFM) analysis, a tapping mode and Si3N4 cantilevers were used for the analysis. Fluorescence spectroscopy of Perkin Elmer Luminescence spectrometer was used.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!