454 flx instrument

Genomic DNA isolated from IL and AC contents were analyzed by 16S amplicon sequencing at the Research and Testing Laboratory (RTL, Lubbock, TX) based upon RTL protocols [43 (link)]. Briefly, the V1-V3 hypervariable region of the 16S rRNA gene was amplified using the Gray28F (5’-GAGTTTGATCNTGGCTCAG-3’) and Gray519R (5’-GTNTTACNGCGGCKGCTG-3’) primer set. Sequencing was performed using the Roche 454 FLX instrument (Roche, Indianapolis, IN, USA). For a detailed description of the sequencing and bioinformatic analyses, refer to Ishak and colleagues [44 (link)]. Raw read data was submitted to the Sequence Read Archive (NCBI) and can be accessed with the accession number SRP049961.

Sequence libraries were constructed using the HotStarTaq Plus Master Mix Kit (Qiagen Ltd., UK) and a one-step PCR with 30 cycles. Bacterial tag encoded amplicon pyrosequencing was carried at the Research and Testing Laboratory (Lubbock, TX) using a Roche 454 FLX instrument with titanium reagents.

Samples were pooled for sequencing as depicted in S1 Fig. For the larvae of the laboratory strain, we made three pools, one pool contained DNA of seven larvae that were reared on each of the three plant species (cotton, tobacco or chickpea). For the larvae of the field population, we made six pools of DNA, two pools (biological replicates) for each plant species, to assess the variation between biological replicates; each pool contained the DNA of five larvae. For the field-lab population, we made two pools, one pool of 45 NoAB larvae and one pool of 49 AB larvae. Before pooling, individual samples were diluted to 25 ng/μl and added in equal volumes to one pool. Pooled samples were sent to an external service provider (Molecular Research Lab, MR DNA, Shallowater, TX, USA) for bTEFAP, using the 16S rRNA primers Gray28F (5’-GAGTTTGATCNTGGCTCA-3’) and Gray519R (5’-GTNTTACNGCGGCKGCTG-3’) [46 (link)]. A sequencing library was constructed via one-step PCR with 30 cycles, using a mixture of Hot Start and HotStar hi-fidelity polymerases (Qiagen). Sequencing was performed on a Roche 454 FLX instrument with Titanium reagents and procedures and protocols of Molecular Research LP (http://www.mrdnalab.com/).

Phylogenetically informative DNA sequences were obtained from each sample by tag-encoded FLX amplicon pyrosequencing targeting the V3 region of the bacterial 16S rRNA gene and the fungal ITS1 region. This analysis was performed by Research and Testing Laboratory (Lubbock, TX), using a Roche 454 FLX instrument with Titanium reagents as previously described[36 ]. The primers used for bacterial sequencing were 341F (CCTACGGGAGGCAGCAG)[37 ] and 907R (CCGTCAATTCMTTTGAGTTT)[38 ]. The primers used for fungal sequencing were ITS1F (CTTGGTCATTTAGAGGAAGTAA)[39 (link)] and ITS3R (TCCTCCGCTTATTGATATGC)[40 ].

DNA extraction, PCR amplification and sequencing of 16S rRNA gene amplicons from the vaginal tract of study participants were conducted in a prior study^{30 (link)}. Briefly, the V1-V3 region of the 16S rRNA gene was PCR amplified using the primers 27F-YM + 3^{107 (link)} and 534R^{57 (link)} and pyrosequenced using a Roche 454 FLX instrument. Species level assignments of Lactobacillus were performed using higher order Markov Chain models using the software speciateIT (speciateIT.sourceforge.net)^{33 (link)}. For each sample, community state types (CSTs) were assigned to individual samples based on diversity and relative abundances of different phylotypes as defined in the work of Gajer and Brotman et al.^{108 (link)}. The vaginal microbiota samples were categorized into CST-I (L. crispatus-dominated), CST-III (L. iners-dominated) and CST-IV (low-Lactobacillus/high strict and facultative anaerobes) (Table 2) Two other well-documented CSTs, CST-II (L. gasseri-dominated) and CST-V (L. jensenii-dominated) were not identified in this limited sample and are less commonly found even in larger surveys of women^{33 (link)}.