Total RNA was isolated using a previously described protocol (7 (link)) for the PureLink FFPE total RNA isolation kit (Invitrogen). Briefly, cells were sorted into the melting buffer containing 1600 U/mL RNase inhibitor (Bioline) and 10 mM DTT (Sigma-Aldrich Ltd.) and stored at −80°C before proceeding to the proteinase K treatment for 15 min at 60°C. Subsequently the manufacturers instructions were followed, including the optional DNase digestion. The RNA was further cleaned using the RNeasy Mini Kit RNA Cleanup protocol (Qiagen). RNA concentrations were measured using the NanoDrop 2000 (Thermo Scientific) and RNA integrity assessed using the 2100 Bioanalyser instrument (Agilent Technologies, Inc.).
Rnase inhibitor
Manufactured by Meridian Bioscience
Sourced in Australia
The RNase inhibitor is a laboratory product designed to protect RNA samples from degradation by ribonuclease (RNase) enzymes. It functions by inhibiting the activity of RNase, thereby preserving the integrity of RNA molecules during various experimental procedures.
Automatically generated - may contain errors
Lab products found in correlation
Immomix, by Meridian Bioscience (2 mentions)
Nanodrop 2000, by Thermo Fisher Scientific (2 mentions)
Nanodrop, by Thermo Fisher Scientific (2 mentions)
Purelink ffpe total rna isolation kit, by Thermo Fisher Scientific (1 mentions)
2100 bioanalyser instrument, by Agilent Technologies (1 mentions)
Rneasy mini kit rna cleanup protocol, by Qiagen (1 mentions)
Dithiothreitol (dtt), by Merck Group (1 mentions)
Random primer, by Promega (1 mentions)
M mlv buffer, by Promega (1 mentions)
M mlv reverse transcriptase, by Promega (1 mentions)
Trisure rna extraction reagent, by Meridian Bioscience (1 mentions)
Bioscript reverse transcriptase kit, by Meridian Bioscience (1 mentions)
Mini beadbeater 96, by Biospec (1 mentions)
Tetro reverse transcriptase kit, by Meridian Bioscience (1 mentions)
Rneasy column, by Qiagen (1 mentions)
Sybr green 1, by Cambrex (1 mentions)
Trizol, by Thermo Fisher Scientific (1 mentions)
Omniscript reverse transcription kit, by Qiagen (1 mentions)
Rotor gene 6000, by Qiagen (1 mentions)
Sybr safe, by Thermo Fisher Scientific (1 mentions)
8 protocols using rnase inhibitor
1
FFPE Total RNA Isolation Protocol
2
cDNA Synthesis and PCR Amplification Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
cDNA synthesis by reverse transcription used standard methods. More specifically, a 25 µL reaction contained 5 µL of 5× Moloney murine leukemia virus (M-MLV) Buffer (Promega, Madison, WI, USA), 100 µM each of dATP, dCTP, dGTP and dTTP (dNTP) (Qiagen, Germantown, MD, USA), 1 µL of M-MLV Reverse Transcriptase (Promega; 200 U/µL), 1 µL RNAse Inhibitor (Bioline; Memphis, TN, USA, 40 U/µL), 250 ng of random primers (Promega) and 1 µg total RNA. The cDNA was then used as a template for amplification by PCR using standard techniques. For MSRA, the forward primer was TGAGCACCGTTCGCAATGAA while the reverse primer was ATGCAGATTCGGCCATGTCA. For MSRB, the forward primer was AATCTCGGACCAGCAGCGACTATG while the reverse primer was CTCGAGATCACTGCTGGGCAATGGG. For rp49, the forward primer was TGACCATCCGCCCAGCATACA while the reverse primer was TCTCGCCGCAGTAAAC. For each PCR amplification, 40 cycles were used after an initial denaturation at 94 °C for 5 min. The annealing temperatures were as follows: 52 °C for MSRA; 59 °C for MSRB; 50 °C for rp49.
3
Tissue RNA Extraction and cDNA Synthesis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The head and thorax from individual stabilized tissue was transferred into a plastic 2 ml screw-cap vial containing 500 µl of TRIsure RNA extraction reagent (Bioline, London, UK). The tissue was homogenized by adding two 3 mm glass beads and shaking the samples for 1.5 min using a Mini-Beadbeater-96 (BioSpec Products, Bartlesville, OK, USA) sample homogenizer. Total RNA was extracted according to the manufacturer's directions for TRIsure, using 100 µl of amylene-stabilized chloroform, 250 µl of isopropyl alcohol and two washes of 1.0 ml 75% ethanol. Total RNA pellets were eluted in 20 µl of RNase-free water. A standard quantity of 350 ng of total RNA per sample was treated to remove genomic DNA contamination using DNase I amplification grade DNase (Invitrogen, Carlsbad, CA) according to the manufacturer's protocol, and reverse transcribed to cDNA using the BioScript reverse transcriptase kit (Bioline). The BioScript protocol was followed with the following modifications: reactions were primed using 0.5 µg custom synthesized anchored oligo-DT20 and then incubated with 100 U BioScript and 20 U of RNAse Inhibitor (Bioline) at 45°C for 60 min followed by 70°C for 10 min. The resulting cDNA was diluted 5-fold.
4
Reverse Transcription of Total RNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
0.5 µg of total RNA were reversely transcribed using the Tetro Reverse Transcriptase kit (Bioline, Luckenwalde, Germany) according to the following protocol: RNA and RNAse free water were mixed in a total volume of 12 µl containing 0.5 µg RNA. 7 µl of reaction mixture (4 µl fivefold Reaction Buffer, 1 µl dNTP’s (10 mM each), 1 µl Oligo dT18 (10 µM), 1 µl RNase Inhibitor (Bioline, Luckenwalde, Germany). 1 µl Tetro reverse transcriptase were added and the samples were incubated for 1 h at 45 ℃. The reaction was terminated by incubating the sample for 5 min at 85 °C.
5
Quantifying Tendon Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Mouse tail tendons from 3, 6, and 12 week old WT and Hspg2Δ3−∕Δ3− mice were pooled (n = 6 at each age point) to provide ∼50 mg wet weight of tissue for each RNA isolation. Tendons were snap frozen in liquid nitrogen, freeze-shattered using a Mikro dismembranator (B. Braun Biotech International, Melsungen, Germany) and total RNA extracted using Trizol (Invitrogen, Mulgrave, VIC, Australia), purified using Qiagen RNeasy columns (Qiagen, Chadstone Centre, VIC, Australia) and quantified by NanoDrop (ThermoFisher Scientific, Scoresby, VIC, Australia). RNA (1 µg) from each sample was reverse transcribed using Omniscript Reverse Transcription Kit (Qiagen) with random pentadecamers (50 ng/ml; Sigma-Genosys, Castle Hill, NSW, Australia) and RNase inhibitor (10 U per reaction, Bioline, Sydney, NSW, Australia). The cDNA was subjected to qRT-PCR in a Rotorgene 6000 (Qiagen) using Immomix (Bioline, Sydney, NSW, Australia), SYBR Green I (Cambrex Bioscience, Rockland, ME, USA), and 0.3 µM validated murine-specific primers. Relative copy numbers for genes of interest were determined using a standard curve generated from pooled cDNA normalised to Gapdh. PCR primer specificity was confirmed by sequencing (SUPAMAC, Sydney University). Genes, primers, and annealing temperatures are listed in Table 1 .
6
RNA Isolation and PCR Reagents
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
cDNA primers were manufactured by Sigma Genosys (New South Wales, Australia), PCR reagents were purchased from Invitrogen (Victoria, Australia). RNA isolation kits and Omniscript for PCR were purchased from Qiagen (Victoria, Australia). RNase inhibitor and Immomix were purchased from Bioline (Sydney, Australia). SYBR Safe® was purchase from Invitrogen. Genomic DNA isolation kits were purchased from Qiagen. A disposable pellet pestle (Kimble Kontes) and cordless motor for RNA isolation were purchased from Sigma Aldrich.
7
Multiplex qRT-PCR for DENV Serotypes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
At the Institute of Tropical Medicine, Antwerp, RNA was extracted using either a Maxwell RSC Instrument or Qiagen viral RNA minikit. Phocine distemper virus was added to all samples as an internal extraction and polymerase chain reaction (PCR) inhibition control [18] (link) . A multiplex real-time quantitative reverse transcription PCR, which can distinguish between the four DENV serotypes, was then performed using primers and probes, as previously described [19] (link) . Briefly, a 112bp fragment of the NS1 gene of DENV-1 or a 77bp fragment of the E gene of DENV-2 was amplified in 45 cycles by adding 5 μl of RNA to a 25-μl reaction using the Bioline SensiFAST mix, Reverse Transcriptase, and RiboSafe RNase inhibitor.
8
Cartilage Extracellular Matrix and Inflammatory Biomarkers
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
3Fax-Peracetyl Neu5Ac and 2F-Peracetyl-Fucose were purchased from Merck. 96-well glass coverslip microplates were purchased from Ibidi. All lectins were purchased from Vector Labs. Human recombinant IL-1β, IL-6 and TNF-α were purchased from Peprotech. RNeasy Mini Kit and Quantifast SYBR Green were purchased from Qiagen. qScript cDNA SuperMix™ was purchased from VWR. RNase inhibitor was purchased from Bioline. PCR primers were purchased from Eurofins. Human MMP-13 ELISA kit was purchased from Abcam. Teflon™ tape, Live/Dead ® staining kit, alamarBlue ® assay, DAPI, TaqMan ® VIC ® -labelled GAPDH primer and TaqMan ® Universal PCR Master Mix, no AmpErase ® UNG were purchased from Fisher Scientific. Primocin was purchased from InvivoGen. TaqMan FAM™ labelled COL1/2 primers were purchased from Thermo Fisher Scientific. All other materials and reagents were purchased from Sigma-Aldrich unless otherwise stated.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!