ZIKV RNA levels in serum and organs were quantified using the qScript One-Step RT-qPCR Kit (QuantaBio Cat# 96057-200) with ZIKV 1086 and ZIKV 1162c primers with ZIKV 1107 probe (5′-6-FAM- AGCCTACCTTGACAAGCAGTCAGACAC TCAA-3′-BHQ-1 from Integrated DNA Technologies) as described previously [18] (link). RNA standards produced from in vitro transcription of primer and probe target regions were used to generate a standard curve for quantification. All qRT-PCR was performed and analysed using a LightCycler 480 RT-qPCR system (Roche) and LightCycler 480 software (Roche) respectively.
Lightcycler 480 rt qpcr system
Manufactured by Roche
Sourced in Switzerland
The LightCycler 480 RT-qPCR system is a real-time PCR instrument designed for quantitative gene expression analysis. It utilizes a 96-well or 384-well plate format and can accommodate a variety of fluorescent detection chemistries. The system provides reliable and reproducible results for a wide range of applications, including gene expression profiling, genotyping, and microRNA analysis.
Automatically generated - may contain errors
Lab products found in correlation
Lightcycler 480, by Roche (2 mentions)
Qscript one step rt qpcr kit, by Quantabio (1 mentions)
5 6 fam, by Integrated DNA Technologies (1 mentions)
Lightcycler 480 sybr green 1 master mix, by Roche (1 mentions)
Trizol reagent, by Thermo Fisher Scientific (1 mentions)
Primescript rt reagent kit, by Takara Bio (1 mentions)
Trizol, by Thermo Fisher Scientific (1 mentions)
Rneasy mini kit, by Qiagen (1 mentions)
Iscript reverse transcriptase, by Bio-Rad (1 mentions)
Lightcycler 480 sybr green 1, by Roche (1 mentions)
Trizol reagent kit, by Thermo Fisher Scientific (1 mentions)
5 protocols using lightcycler 480 rt qpcr system
1
ZIKV RNA Quantification in Serum and Organs
2
RNA Extraction and RT-qPCR Analysis of Cisplatin Sensitivity
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from cultured cells with TRIzol reagent (Invitrogen; Thermo Fisher Scientific, Inc., Waltham, MA, USA) and1 µg used for cDNA synthesis with a PrimeScript RT reagent kit (Takara Biotechnology Co., Ltd., Dalian, China). Amplification and melting curve analyses were performed using a LightCycler 480 RT-qPCR system and LightCycler 480 SYBR-Green I Master Mix (Roche Applied Science, Mannheim, Germany). Amplification cycles were 95°C for 3 min, 35 cycles at 95°C for 30 sec, 55°C for 30 sec, 72°C for 30 sec, followed by 72°C for 3 min. β-Actin was used for normalization and the relative levels calculated using the 2−ΔΔCt method. Tissue samples were obtained from patients with different recurrence-free survival (RFS) rates (RFS >12 months classified as the cisplatin-sensitive group and RFS ≤12 months as the cisplatin-resistant group), and cDNA hybrids of 32 samples were mixed as the control. Each PCR reaction was performed using one premixed reference template. All reactions were conducted in triplicate.
3
Quantitative RT-PCR Analysis of Cytokine Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated using Trizol (Invitrogen, Carlsbad, USA), and was reverse-transcribed into cDNA using a Super RT cDNA kit. The SYBR green Realtime PCR Master Mix was used for RT-qPCR amplification. The primers used for PCR are shown in Table 1 . The cycling conditions were 95 °C for 10 min, followed by 40 cycles of 60 °C for 15 s, 75 °C for 60 s, and 95 °C. Temperature increases were 1 °C per 20 s. The RT-qPCR analysis was performed with the Light Cycler 480 RT-qPCR System (Roche, Basel, Switzerland). Fold-changes in gene expression were estimated using the CT comparative method normalizing β-actin CT values and relative to control samples as follows: ΔCt = Ct (assayed samples)-Ct(β-actin); ΔΔCt = ΔCt−ΔCt control; fold difference = 2−(ΔΔCT).
Primers used for quantitative RT-PCR
| Genes | Forward (5′–3′) | Reverse (5′–3′) |
|---|---|---|
| β-actin | GGCTGTATTCCCCTCCATCG | CCAGTTGGTAACAATGCCATGT |
| IL-2 | TGAGCAGGATGGAGAATTACAGG | GTCCAAGTTCATCTTCTAGGCAC |
| IFN-γ | ATGAACGCTACACACTGCATC | CCATCCTTTTGCCAGTTCCTC |
| TNF-β | GTCTGTGTATCCGGGACTTCA | TCTCCCTTACTGAGCAGGAAC |
| IL-4 | CCCCAGCTAGTTGTCATCCTG | CAAGTGATTTTTGTCGCATCCG |
4
Quantitative RT-PCR for Dengue Virus
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was extracted from cells using the RNeasy Mini kit (Qiagen 74106). Total RNA was reverse transcribed into cDNA using iScript Reverse Transcriptase (Bio-Rad 1708891). cDNA samples were then amplified by use of LightCycler 480 SYBR Green I (Roche 04707516001) with primers for pan-serotype DENV, BHK21 hypoxanthine-guanine phosphoribosyltransferase (HPRT), BHK21 C-X-C motif chemokine ligand 10 (CXCL10), human mitochondrial cytochrome c oxidase subunit I (mtCOI), human mitochondrial NADH dehydrogenase subunit 4 (mtND4), human mitochondrial cytochrome B (mtCytB), or human glyceraldehyde 3-phosphate dehydrogenase (GAPDH) (see Supplementary Table S1 for primer sequences). All primers were obtained from AITbiotech. RT-qPCR was performed using a LightCycler 480 RT-qPCR system (Roche) and analyzed with LightCycler 480 Software (Roche Diagnostics).
5
Quantitative Real-Time PCR Analysis of T-bet and GATA-3
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The changes in T-bet and GATA-3 mRNAs were explored by a quantitative real-time PCR assay. First, total RNA was extracted with a TRIzol reagent kit (Invitrogen, Carlsbad, USA) and tested for concentration and purity. Then, the RNA was reverse transcribed into cDNA by a Super RT cDNA kit. SYBR® Green PCR Master Mix was used to amplify cDNA in the Multicolour Real-time PCR Detection System. In addition, the sequences for primers are listed in Table 1 . The PCR parameters were as follows: 95°C for 10 min, followed by 40 cycles of 60°C for 15 s, 75°C for 1 min, and 95°C for 15 s. Temperature increases were 1°C per 20 s. RT-qPCR analysis was performed with the Light Cycler 480 RT-qPCR System (Roche, Basel, Switzerland). T-bet and GATA-3 mRNA levels were normalized to the endogenous reference GAPDH, and the results were calculated by the 2−ΔΔCt method.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!