Ab12209

The mononucleosome fraction was incubated with either anti-γH2AX (Upsate, 05-636) or anti-H3K4me3 (Abcam, ab12209) or anti-TH2BS11ph for overnight at 4 °C. Protein A or Protein G dynabeads were added the next day. LSDB250 buffer was used as the wash buffer for immunoprecipitation studies with mononucleosomes. After the washes, the beads were either proceeded with DNA extraction for PCR analysis or boiled in 5× SDS dye for western blotting. After washing of beads, DNA was eluted from the beads as follows—210 µl of the elution buffer was added, incubated at 65 °C overnight for de-crosslinking. 200 µl of TE buffer was added the next day, subjected for RNase (final; 40 µg/ml) and proteinase K (Final; 100 µg/ml) treatment and DNA were extracted by phenol–chloroform method. DNA that was purified from TH2BS11ph ChIP was proceeded for ChIP-seq analyses. SYBR kit from TAKARA was used to set up quantitative PCR reactions. PCR was carried out for 40 cycles and was followed by melt curve analyses before recording the raw Ct values. The fold enrichment values were calculated over input taking the percentage of input used for the ChIP procedure and the Ct values obtained for the target genomic region from Input and ChIP DNA. PCR was carried out in duplicates for each of the three biological replicates. $$\text{Fold}\text{Enrichment}\text{over}\text{Input}=\%\text{of}\text{Input}\times 2^{\left[\text{Ct}\left(\text{Input}\right)-\text{Ct}\left(\text{ChIP}\right)\right]}$$

iPSCs were differentiated for 7 days using an adapted protocol from^{13 (link)}. Whole cell protein extracts were isolated and western blotting was performed using standard western blotting protocols using 8-12% polyacrylamide gels. Primary antibodies used were H3K27me3 (1:500; 39155, Active Motif), H3K4me3 (1:1000; ab12209, Abcam), EZH2 (1:5000; 5246, Cell Signalling), SMAD3 (1:2000; ab28379, Abcam), phosphorylated SMAD3 (1:2000; ab52903, Abcam). Beta-actin (1:20,000; A5316, Sigma) served as a loading control. Detection was performed using Advansta WesternBright ECL (Advansta, cat. no. K12045) and the Vilber Fusion XF Imager.

The antibodies used for immunofluorescence were against E-cadherin (13-1900, Invitrogen and 610182, BD Transduction Laboratories), N-cadherin (610921, BD Transduction Laboratories), ZO-1 (617300, Invitrogen), fibronectin (F-3648, Sigma-Aldrich), paxillin (610052, BD Transduction Laboratories), GFP (chicken, Aves Labs), SATB2 (Abcam, ab34735), beta-actin (C4, sc-47778, Santa Cruz), FBXO32 (sc-33782, Santa Cruz) (ab168372), ZEB1 (sc-25388 (H-102) Santa Cruz), ATF-3 (sc-188 (C-19) Santa Cruz), Cleaved caspase 3 (Asp175, 9661 S, cell signaling), FLAG tag M2 (F1804, Sigma), HA tag monoclonal antibody (c15200190, Diagenode), Myc tag (ab9106, Abcam), Ub mouse monoclonal (sc8017, Santa Cruz), Lamin B (sc-6216 (C-20), Santa Cruz), Histone H3 tri methyl K4, (ab12209, Abcam), Histone H3 tri methyl K9, (ab8898, Abcam), Histone H3 acetyl K27, (ab4729, Abcam), Alexa Fluor-488 goat anti-mouse IgG (H + L) (A11029, Invitrogen); Alexa Fluor-568 goat anti-rabbit IgG (H + L) (A11011, Invitrogen), Alexa Fluor-633 goat anti-rat IgG (H + L) (A21094, Invitrogen), and Alexa Fluor-633 phalloidin (A22284, Invitrogen), which was used to stain F-actin.

ChIP assay was performed by using EZ‐Magna ChIP Kit (EMD Millipore, Billerica, MA, USA). Hep3B and MHCC97H cells were crosslinked by 4% formaldehyde and incubated with 0.125 M Glycin to crosslink DNA and protein. Next, cells were lysed and subjected to sonication to obtain 500 ~ 1000bp chromatin fragments. The lysates were incubated with primary antibodies Rabbit IgG (ab171870, Abcam; NC), anti‐KDM5A (ab70892, Abcam) and anti‐H3K4me3 (ab12209, Abcam) (IgG as negative control, H3K4me3 or KDM5A). The precipitated DNAs were analysed by RT‐qPCR. According to the predicted binding sites of KDM5A, the ChIP primers were designed as below: F: 5'‐GTTTCGCAGAGATAGCTTGGAG–3', R: 5'‐GGGGTGAAACTGAACAAGAACG‐3'.

Extraction of total proteins and immunoblotting were conducted as previously described [92 (link)]. Rabbit polyclonal antibodies were raised against purified recombinant full-length A. thaliana OTU1, OTU2, OTU5b, RPN8a, RPN10, RPN13, RAD23c, DDI1, and NUB1 (custom-made by Genesis Biotech or Cashmere Biotech, Taipei, Taiwan). Rabbit polyclonal antibodies made against A. thaliana PBA1, RPT2, RPT5, RPN5, RPN6, and RPN12 were purchased from Enzo Life Sciences. The global levels of H3 marks and ubH2B in wild-type and otu5-1 plants were detected from nuclear-enriched protein extracts of 10-day-old seedlings following the chromatin extraction and sonication of the ChIP protocol, and the chromatin solution was diluted with 2× loading buffer and denatured at 100 °C for 10 min. The samples were examined by immunoblotting with specific rabbit polyclonal antibodies against H3K36me3 (ab9050, Abcam), H3K27me3 (ABE44, Millipore), H3K36me1 (ab9048, Abcam), histone H3 (ab1791, Abcam), or mouse monoclonal antibodies against H3K4me3 (ab12209, Abcam) or ubH2B (MM-0029, Médimabs). A chemiluminescent system (Perkin Elmer) was used to develop the protein blots according to the manufacturer’s instructions.

ChIP was performed with slight modifications based on Schmidt et al. [68 (link)]. Briefly, one cross-linked E14.5 liver was used per IP with antibodies as follows: IgG, 5 μg sc-2027 (Santa Cruz Biotechnology, Santa Cruz, CA, USA); anti-H3K4me3, 5 μg C42D8 (Cell Signaling Technology, Danvers, MA, USA), or 5 μg ab12209 (abcam, Cambridge, MA, USA); anti-H3K9me3, 5 μg ab8898 (abcam); anti-H3K27me3, 3 μg C36B11 (Cell Signaling Technology) or 5 μg ab6002 (abcam); anti-H3K27ac, 0.5 μg #4353 (Cell Signaling Technology) or 5 μg ab4729 (abcam). Real-time PCR quantification of chromatin pull-down was performed as described above and amounts were normalized to the level of input material prior to immunoprecipitation. ChIP primer sequences have been described previously for Klf8 promoter 1a and Fam132a[49 (link),50 (link)]. Other primers used are as follows: Pu.2 ORR1A0 -250 bp, 5′-GAAGTCCTTCTGGCTTCTGCAT-3′ and 5′-CTGACCTTGTCTAACCCTTTTGTTTA-3′; Pu.2 ORR1A0 -120 bp, 5′-GACAAGGTCAGGAGAGGTTT-3′ and 5′-CCACAGTGACACACCCAT-3′; Myod1, 5′-TCCTATGCTTTGCCTGGTCT-3′ and 5′-GGAAGGAGGGCAGAGAGACT-3′; Serpina9, 5′-TGTGCTGGACCTGGTTTGTA-3′ and 5′-CTGGCAGCTCTCACCTCTCT-3′, and; Gapdh, 5′-GACAGTCGGAAACTGGGAAG-3′ and 5′-CATCACGTCCTCCATCATCC-3′. Base positions refer to where amplicons are centered relative to the TSS.