Anti smad2 3 antibody

Mouse tissue was lysed in RIPA buffer (50 mM Tris-HCl, pH 7.4, 150 mM NaCl, 1% Triton X-100, 1% sodium deoxycholate, 0.1% sodium dodecyl sulfate, 1 mM EDTA) containing 1x protease inhibitor cocktail (Roche Diagnostics). The samples were subjected to sonication for 5 to 10 sec, followed by centrifugation at 16,000 g for 5 min at 4°C. The concentration of supernatant protein was determined using the Bio-Rad DC Protein Assay Kit, and 5 μg was fractionated through 8% polyacrylamide gels under denaturing conditions. Proteins transferred to poly(vinylidene difluoride) membrane were probed with anti-Smad2/3 antibodies (Cell Signaling) at 1:1,000 dilution. Primary antibody binding was visualized using horseradish peroxidase-conjugated rabbit anti-mouse antibodies (Dako Scientific) and enhanced chemiluminescence (Thermo Scientific). Membranes were reprobed with horseradish peroxidase-conjugated antibody against β-actin (1:10,000 dilution, Cell Signaling) to control for the amount of protein loaded onto the gels. Membranes were imaged on a ChemiDoc MP imager (Bio-Rad) and signals were quantified using Image Lab 4.1 software.

ChIP assays were performed using the MAGnify ChIP system (Invitrogen) according to the manufacturer's guidance. Briefly, CD4⁺ iTreg cells were generated as described above and FACS prior to overnight activation with αCD3/αCD28‐conjugated beads. iTregs were then fixed with 2% formaldehyde and sonicated. DNA was immunoprecipitated with anti‐Smad2/3 antibodies (Cell Signaling Technology). The immunoprecipitated chromatin was analyzed on a Roche LightCycler 480 by SYBR Green using the following primers for the murine Usp44 promoter:

Forward: 5′‐GCACTACATTATGGAATGTG‐3′

Reverse: 5′‐CTAAGTAGAAACTCGTCCGG‐3′

Analysis by immunohistochemistry was performed according to protocols described previously^{25 (link)}. Briefly, 3 μm serial sections were prepared from paraffin-embedded materials and subjected to hematoxylin–eosin (H&E) staining and immunohistochemistry using antibodies, including an anti-CK-19 antibody (The Developmental Studies Hybridoma Bank, University of Iowa, Iowa City, IA, USA), an anti-TAg antibody (Santa Cruz Biotechnology, Santa Cruz, CA, USA), and an anti-Smad2/3 antibody (Cell Signaling Technology). For visualization of the immune complexes, the Vectastain Elite ABC Kit (Vector Laboratories, Burlingame, CA, USA) was used.