Hccc 9810

Primary intrahepatic cholangetic epithelial cells were purchased from iCell (Shanghai, China), and cultured with primary epithelial cell medium (iCell) at 37 °C with 5% CO₂. The primary intrahepatic cholangeitc epithelial cells were identified by immunofluorescent staining of cytokeratin 19 (CK19), and the results were shown in Fig. S12. The cell culture and identification was consistent with our previous reports [12 (link)].
Cholangiocarcinoma cell lines HCCC-9810 and RBE were purchased from Procell (Wuhan, China), and HUCCT1 from Zhongqiaoxinzhou (Shanghai, China). The cells were cultured in RPMI-1640 medium (Gibco BRL, Gaithersburg, USA) supplemented with 10% fetal bovine serum (FBS) (Hyclone, Logan, USA) at 37 °C with 5% CO₂. The cell lines have been authenticated by STR, and test as mycoplasma negative.
Cell transfection was performed with Lipofectamine 2000 reagent (Invitrogen, Carlsbad, USA) in serum-free medium according to the manufacturer’s protocol.
To obtain the stably transfected cell line, HCCC-9810 cells were transfected with MT1JP overexpression plasmid, and treated with 400 μg/ml G418 for 2 weeks. The single cells were selected out, and cultured without G418. After verification of MT1JP at RNA levels, the MT1JP-stably expressed cell lines were obtained.

Human CCA cell lines, HuCCT1 (Cat#CL-0725) and HCCC-9810 (Cat#CL-0095) were purchased from Procell (Wuhan, China), TFK-1 (Cat#BFN60808817) was purchased from Bluefbio (Shanghai, China), HuH28 (Cat#CTCC-003-073) was purchased from Meisen Chinese Tissue Culture Collections (Zhejiang, China), QBC939 and SK-ChA-1 were obtained from Guangzhou Medical University (Guangzhou, China). One human embryonic kidney HEK293T (Cat#CRL-3216) cells was purchased from American Type Culture Collection (Manassas, VA, USA). HuCCT1, HCCC-9810, HuH28 and QBC939 were cultured in RPMI-1640, TFK-1, SK-ChA-1, and HEK293T cells were cultured in DMEM, all were supplemented with 10% fetal bovine sera, 100 units/mL penicillin and 100 units/mL streptomycin. All cells were maintained in a humidified incubator at 37 °C with 5% CO₂.

The ICC cell line, 273cc, was isolated from SPC mice. For in vitro cell culture, cells were grown in complete F-medium as previously described [10 (link)]. Cell proliferation was measured using the Alamar Blue assay, according to the manufacturer’s protocol. Briefly, cells were incubated in 10% v/v Alamar Blue (Sigma, R7017) at 37 °C for 2 h in 96-well plates. At the end of the incubation period, fluorescence was monitored at 590 nm using an excitation wavelength of 530–560 nm. Human CC cell line QBC939 was obtained from Prof. Chundong Yu (Xiamen University, China), and HCCC9810 was purchased from Procell Life Science and Technology.

The human ICC cell lines HCCC-9810 (CVCL_6908), RBE (CVCL_4896), QBC-939 (CVCL_6942) and HuCC-T1 (CVCL_0324) were obtained from Procell (Wuhan, China). All cells were cultured at 37°C in a constant temperature incubator in RPMI 1640 medium (Gibco, Carlsbad, USA) supplemented with 10% serum.

We obtained CCA cell strains including HUCCT1, RBE, CCLP-1, huh28, QBC939 and HCCC-9810 from Procell (Wuhan, China). All cells were cultured in Roswell Park Memorial Institute 1640 medium (Gibco, USA) supplemented with 10% foetal bovine serum and incubated at 37℃ with 5% CO₂. An EGFP-Puro-CMV-3 × Flag hSPRYD4 vector was constructed by Generay Biotech Co., Ltd. (Shanghai, China). Mixed with the pPACKH1 packaging plasmid, the SPRYD4-OV vector was transfected into 293 T cells. The virus particles were collected from the concentrated virus precipitation solution following the SBI instructions. The cells were infected with TUNDUX virus transducers. Following this, puromycin screening was used to identify the positive cells. For the generation of cell lines with SPRYD4 knockdown, two siRNAs targeting SPRYD4 were transfected into CCA cells to silence SPRYD4. The siRNAs used in the study were obtained from sequences (5’- 3’) shown below:

GCCCCAAAUCAGAAAAUAAAC

AAGGCGCAAGAUGGCGCUGCU

Human CCA cell lines HCCC-9810 and RBE were obtained from Procell Life Science & Technology Co.,Ltd. (Wuhan, China) and cultured in RPMI-1640 medium (Thermo Fisher Scientific, USA) containing 10% fetal bovine serum (FBS, Thermo Fisher Scientific). Human intrahepatic biliary epithelial cells (HIBE) were provided by ScienCell Research Laboratories (USA) and maintained in EpiCM (ScienCell) containing 10% FBS. All cell lines were authenticated using STR profiling and tested for no mycoplasma contamination.