Sybr green premix ex taq

Total RNA was extracted from cell lines via RNA-easy isolation reagent (Vazyme biotech) and was reversed into synthesizing complementary DNA (cDNA) using PrimeScript Mix reagent (Takara). The PCR reaction system was prepared to utilize SYBR Green® Premix Ex Taq™ (Vazyme biotech). Results of individual lncRNAs were normalized to the expression of GAPDH. The primer sequences for each gene are shown in Supplementary Table S2.

Total RNA of cell were extracted by TRIzol RNA extraction agent (Thermo Fisher Scientific, USA) according to manufacturer manual. RNA concentration were measure by absorbance at 260 nm, then reverse transcribed via reverse transcriptase kit (Vazyme Biotech Co.,Ltd, China) followed by real-time PCR amplification by use of SYBR Green Premix ExTaq (Vazyme Biotech Co., Ltd, China). Data were interpreted using the 2^−ΔΔCt method, with GAPDH serving as the reference gene for normalization. The primer of GSDMD were: GTGTGTCAACCTGTCTATCAAGG (forward strand) and CATGGCATCGTAGAAGTGGAAG (reserved strand). The primer of GAPDH were: GGAGCGAGATCCCTCCAAAAT (forward strand) and GGCTGTTGTCATACTTCTCATGG (reserved strand).

Total RNA from each cell line was extracted with an RNA-easy isolation reagent, and reversed with HiScript® III RT SuperMix for qPCR (+gDNA wiper) (both Vazyme Biotech, China) to synthesize complementary DNA (cDNA). The PCR system was made from SYBR Green® Premix Ex Taq™ (Vazyme Biotech, China). Results of individual lncRNAs were standardized to the GAPDH expression. The primer sequences for LINC00861 and GAPDH are listed in Table S2.