Primary CD326+ IECs were seeded on gelatin (Cell Biologics; Chicago, IL) coated cell culture dishes (100mm) overnight followed by treatment with butyrate 1mM for 24 hours. Cells were harvested and used for ChIP analysis using EZ-Magna ChIP kit from EMD Millipore (Billerica, MA) following the manufacturers instructions. Briefly, cells were cross-linked with 1% formaldehyde and extracted chromatin was sonicated using a Bioruptor Pico by Diagenode (Denville, NJ) to yield DNA fragments predominately in the range of 200 – 1000bp. Sonicated lysates were immunoprecipitated (IP) utilizing ChIP grade specific antibodies purchased from EMD Millipore for acetylated histone-H4 and RNA Pol II or IgG control antibody. De-crosslinked DNA was next examined by qPCR using primers targeting the promoter region of the target gene BCL-B (Bcl2l10) (Forward: CCTACTCTGCCTGGCTCTTT; Reverse: ACCCTTCTGAGTCCCTGAGA), Slc5a8 (Forward: CACAGCACAGCCTTCTTTGT; Reverse: TCCAGTTCACAGTCCAGGTC), and JAM (F11r) (Forward: TGCCGGGATTAAAAGCATGG; Reverse: ACAGGGACAGCAGGATTAGG). IP efficiency of all samples was verified by qPCR analysis of the promoter region of Gapdh (Forward: CTGCAGTACTGTGGGGAGGT; Reverse: CAAAGGCGGAGTTACCAGAG). Data analysis was determined as percent of input utilizing the equations: ΔCt[normalized ChIP] = (Ct[ChIP] − (Ct[Input] − Log2 (6.644))) and % Input = 2(−ΔCt [normalized ChIP]).
Gelatin
Manufactured by Cell Biologics
Sourced in United States
Gelatin is a protein-based material derived from collagen, a structural protein found in animal connective tissues. It is a versatile laboratory reagent used in various applications, such as cell culture and protein purification. Gelatin serves as a gelling agent, stabilizer, and matrix material, providing a suitable environment for cell growth and biomolecule interactions.
Automatically generated - may contain errors
Lab products found in correlation
Chip grade specific antibodies, by Merck Group (2 mentions)
Ez magna chip kit, by Merck Group (2 mentions)
Bioruptor pico, by Diagenode (2 mentions)
Incucyte zoom instrument, by Sartorius (1 mentions)
Incucyte zoom 2018a software, by Sartorius (1 mentions)
Penicillin streptomycin p s, by Corning (1 mentions)
Dulbecco s modified eagle media, by Corning (1 mentions)
Egm 2, by Cell Biologics (1 mentions)
6 well cell culture plate, by Corning (1 mentions)
D glucose, by Merck Group (1 mentions)
Fetal bovine serum (fbs), by Corning (1 mentions)
L glutamine, by Corning (1 mentions)
Sodium pyruvate, by Corning (1 mentions)
24 well cell culture plate, by Corning (1 mentions)
Ecis software, by Applied Biophysics (1 mentions)
4 protocols using gelatin
1
ChIP Analysis of Butyrate-Treated IECs
2
Pericyte Proliferation Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Pericytes were seeded at 8000 cells/mL into two 6‐well cell culture plate (Corning Inc., Corning, NY, USA) precoated with gelatin (Cell Biologics Inc.) in either Dulbecco's modified Eagle media (DMEM) with 4.5 g·L−1 glucose, l ‐glutamine, and sodium pyruvate (Corning Inc.) supplemented with +5% FBS (Corning Inc.) +1% penicillin/streptomycin (P/S) (Corning Inc.) or endothelial growth medium 2 (EGM‐2; Cell Biologics, Inc., Chicago, IL, USA) supplemented with the ECs medium supplement kit (Catalog M1168, Cell Biologics Inc., Chicago, IL, USA). Cells were seeded at 10 000 cells per well into a 24‐well cell culture plate (Corning) precoated with gelatin (Cell Biologics Inc.) in cell culture media. After 6 h for cells to attach, media was changed to include LDL (Sigma) or d ‐glucose (Sigma). Plates were placed into an Incucyte Zoom instrument (EssenBioscience Inc., Ann Arbor, MI, USA) integrated with the incucyte zoom 2018A software (EssenBioscience Inc., Ann Arbor, MI, USA), and growth was monitored for 5 days to construct proliferation curves.
3
Cardiac Cell Impedance Measurements
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cardiac PCs or SMCs at P7 were seeded onto 96‐well 20idf plates (Applied Biophysics Inc., Troy, NY, USA) that were pretreated with cysteine solution (Applied Biophysics Inc.) and coated with gelatin (CellBiologics, Inc., Chicago, IL, USA). Cells were plated at 25 000 cells per well at 200 µL per well. Cells were settled at room temperature for 30 min before the plate was transferred to the ECIS ZTheta 96W module (Applied Biophysics Inc.) inside a cell incubator kept at 37 °C and 5% CO2. Measurements were made in the single frequency mode at 8000 Hz for 24 h. At the 24 h of time point, plate was removed from module, half of the media (100 µL) aspirated off, and treatments or pretreatments (such as inhibitors) of 100 µL at 2× concentration were added in. Plate was subsequently moved back into the incubator and measurements resumed for another 24 h. Analysis was done using the ecis software (Applied Biophysics Inc.). Impedance was normalized to the time point right before treatment was added. Delta impedance was measured at peak contraction or relaxation from the time point right before treatment was added. See Table 2 for treatment compounds used.
4
ChIP Analysis of Butyrate-Treated IECs
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!