Forebrains of Calhm1+/+ or Calhm1−/− mice were homogenized in homogenization buffer (10 mM HEPES, pH 7.4, 320 mM sucrose) containing proteases and phosphatases inhibitors (Roche Applied Science). Cells debris and nuclei were removed by 1,000 × g centrifugation. The supernatant was spun for 20 min at 12,000 × g, resulting in supernatant and P2 pellet. The latter was resuspended in a buffer containing 4 mM HEPES, 1 mM EDTA, proteases and phosphatases inhibitors, and spun for 20 min at 12,000 × g. The resulting pellet was resuspended again in HEPES buffer and spun for 20 min at 12,000 × g. The resulting pellet was resuspended in a buffer containing 20 mM HEPES, pH 7.2, 100 mM NaCl, 0.5% Triton X-100, proteases and phosphatases inhibitors, and rotated slowly for 15 min before being spun for 20 min at 12,000 × g. The supernatant was used as the non PSD fraction and the pellet was resuspended in a buffer containing 20 mM HEPES, pH 7.5, 0.15 mM NaCl, 1% Triton X-100, 1% deoxycholic acid, 1% SDS, 1 mM DTT, proteases and phosphatases inhibitors, allowed to rotate gently for 1 h and spun for 15 min at 10,000 × g. The resulting supernatant was used as the PSD fraction. For WB analyses, whole brain and PSD extracts were separated by SDS-PAGE and transferred to nitrocellulose membranes, as described before12 (link).
Proteases and phosphatases inhibitors
Manufactured by Roche
Sourced in Switzerland, Germany
Proteases and phosphatases inhibitors are laboratory reagents used to regulate the activity of enzymes involved in protein degradation and modification. These inhibitors are designed to maintain the integrity and stability of proteins during experimental procedures. They serve as essential tools for researchers studying cellular processes, signal transduction, and protein structure and function.
Automatically generated - may contain errors
Lab products found in correlation
Agarose, by Thermo Fisher Scientific (1 mentions)
Pierce bca protein assay kit, by Thermo Fisher Scientific (1 mentions)
Supersignal west pico plus, by Thermo Fisher Scientific (1 mentions)
Fusion fx, by Vilber (1 mentions)
Nitrocellulose membrane, by GE Healthcare (1 mentions)
Ripa buffer, by Merck Group (1 mentions)
Benzonase, by Merck Group (1 mentions)
Olaparib, by Cayman Chemical (1 mentions)
Anti lc3, by Cell Signaling Technology (1 mentions)
Anti pchk1 ser345, by Cell Signaling Technology (1 mentions)
Sds page minigels, by Bio-Rad (1 mentions)
Anti hsp90, by Santa Cruz Biotechnology (1 mentions)
Anti gfp, by Santa Cruz Biotechnology (1 mentions)
Anti p62, by Abcam (1 mentions)
Ptp1b, by BD (1 mentions)
Iscript cdna synthesis kit, by Bio-Rad (1 mentions)
Rnaeasy kit, by Qiagen (1 mentions)
Precast gel, by Thermo Fisher Scientific (1 mentions)
Pvdf membrane, by Merck Group (1 mentions)
Flag tag (flag), by Merck Group (1 mentions)
10 protocols using proteases and phosphatases inhibitors
1
Calhm1 Knockout Mouse Brain Fractionation
2
Co-immunoprecipitation of ERK1/2 Proteins
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For co-immunoprecipitation assay cells washed with PBS were lysed in ice-cold Pierce IP buffer (25 mM Tris-HCl pH7.4, 150 mM NaCl, 1 mM EDTA, 1% NP-40, 5% glycerol) with proteases and phosphatases inhibitors (Roche). Lysates were cleared by 10 min centrifugation at 12000 g. Overnight precipitation was performed with 2 µg of mouse monoclonal antibodies to ERK1/2 (4695, Cell Signaling), isotype specific antibodies (3900, Cell Signaling) at the same concentration were used as negative IP control. 500 µg of cell lysates pre-cleaned with normal horse serum and 50 µl of 50% Protein a/g Agarose (Invitrogen). Agarose beads were washed 5 times with IP buffer with centrifugation at 2000 g and boiled in SDS-loading buffer. Not precipitated lysate aliquots were used as loading control.
3
Protein Extraction from Adipose Tissue
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Fat tissue explants were placed into lysis buffer (125 mmol/l Tris-HCl, 2% SDS, pH 7.4) containing proteases- and phosphatases-inhibitors (Roche) and homogenised with beads (Azer Scientific). The obtained lysates were incubated for 1 h at 4 °C under rotation and then centrifuged (14,000 × g, 10 min, 4 °C) to pellet the insoluble cell debris. The upper fatty layer was removed and the clear underlying fraction underwent a further protein-extraction step to minimise lipid contamination54 (link). Briefly, 500 µl of tissue lysate were diluted in 1875 µl of a methanol-chloroform (2:1) mixture and after a 15 min incubation on ice, 625 µl of chloroform and 625 µl of water were added to change the water/chloroform/methanol ratio from 0.8:1:2 to 1.8:2:2. After centrifugation (800 × g, 5 min, 4 °C), the protein disk lying between the lower lipid phase and the upper aqueous phase was collected, dissolved in lysis buffer and the protein concentration was determined with the Pierce BCA™ Protein Assay Kit (ThermoFisher Scientific) according to the manufacturer’s instruction.
4
Protein Detection in Cytokine-Stimulated Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
After the stimulation with cytokines, cells were washed once with ice-cold PBS, collected, centrifuged and lysed for 30 minutes on ice in RIPA buffer (Sigma) supplemented with proteases and phosphatases inhibitors (Roche). An equal amount of the protein was loaded and separated by SDS-PAGE electrophoresis, followed by wet transfer on the nitrocellulose membrane (GE Healthcare). The membrane was further incubated for 1 hour in blocking buffer (5% BSA in TBS-T). Further, membranes were probed overnight with primary antibodies, listed in Supplementary Table 2
5
Cell Lysis and Protein Extraction
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For MMS treatment, cells were damaged with 2 mM MMS (Sigma-Aldrich; St. Louis, MO, US) for 1 hr. In case of H2O2, cells were damaged with 2 mM H2O2 (Sigma-Aldrich; St. Louis, MO, US) for 10 min. Cells were lysed as previously described (Fontana et al., 2017 (link)) in the following buffer: 50 mM Tris-HCl pH 8.0, 100 mM NaCl, and 1% Triton X-100. Immediately before lysing the cells, the lysis buffer was supplemented with 5 mM MgCl2, 1 mM DTT, proteases and phosphatases inhibitors (Roche; Basel, Switzerland), 1 μM ADP-HPD (Calbiochem, La Jolla, CA), and 1 μM Olaparib (Cayman Chemical, Ann Arbor, MI). After the cell pellet was resuspended in the supplemented lysis buffer, Benzonase (Sigma-Aldrich; St. Louis, MO, US) was added (Fontana et al., 2017 (link)).
6
HEK293 Cells Western Blot Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
HEK293 cells (3 × 105) were seeded in 6-well plate and treatment with selected extracts was performed for 16 h unless indicated. For western blot analysis, cells were collected and homogenized in 1% Triton X-100 in PBS containing proteases and phosphatases inhibitors (Roche). After sonication, protein concentration was determined in all experiments by micro-BCA assay (Pierce), and 10–30 µg of total protein was loaded in 8–15% SDS-PAGE minigels (Bio-Rad Laboratories, Hercules, CA) prior transfer into PVDF membranes. Membranes were blocked using PBS, 0.1% Tween-20 (PBST) containing 5% milk for 60 min at room temperature and then probed overnight with primary antibodies in PBS, 0.02% Tween-20 (PBST) containing 5% skimmed milk. The following primary antibodies and dilutions were used: anti-GFP 1:1,000 (Santa Cruz, Cat. n° SC-9996), anti-HSP90 1:5,000 (Santa Cruz, Cat. n° SC-13119), anti-LC3 1:1,000 (Cell signaling, Cat. n° 3868), anti-p62 1:5,000 (Abcam, Cat. n° ab56416), Anti-pCHK1(Ser345) 1:1,000 (Cell Signaling, Cat. n° CST-2348). Bound antibodies were detected with peroxidase-coupled secondary antibodies incubated for 2 h at room temperature and the ECL system.
7
Quantifying Omomyc Expression and Protein Levels
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cells grown and treated or not with doxycycline for 3 days were either used for RNA extraction with a RNAeasy kit (Qiagen) according to manufacturer’s instructions, or lysed in RIPA buffer with proteases and phosphatases inhibitors (Roche). RNA was retro-transcribed with the iScript cDNA Synthesis Kit (Bio-Rad) and quantitative PCR with reverse transcription was performed using the following Taqman probe for Omomyc: 5′-/56- FAM/ATTTCAGAAATGAGCTTTTGCGTCTC /36-TAMSp/-3′. Protein extracts were run on 10% or 12% precast gels (Life Technologies), transferred to PVDF membranes (Millipore) and incubated with antibodies against SAE1 (Novus Biologicals, 1:1,000), PTP1B (BD Biosciences, 1:2,000), FLAG (Sigma, 1:4,000) or actin (Sigma, 1:200,000). Complete western blot images are included as Supplementary Fig. 5 .
8
Co-Immunoprecipitation of EB1 Complexes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For co-immunoprecipitation assay cells washed with PBS were lysed at 0°C or 37°C in Pierce IP buffer (25mM Tris-HCl pH7.4, 150mM NaCl, 1mM EDTA, 1% NP-40, 5% glycerol) with proteases and phosphatases inhibitors (Roche). Lysates were cleared by 10 min centrifugation at 12000g. Overnight precipitation was performed with 2μg of EB1 antibodies, 500 μg of cell lysates pre-cleaned with normal horse serum and 50 μl of 50% Protein a/g Agarose (Invitrogen). Agarose beads were washed 5 times with IP buffer with centrifugation at 2000g and boiled in SDS-loading buffer. Not precipitated lysate aliquots were used as loading control.
9
Protein Separation and Analysis by Western Blot
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cell homogenates were prepared by ultrasonication in a buffer containing detergents and proteases and phosphatases inhibitors (Roche Applied Science, Mannheim, Germany). Proteins were separated on NuPAGE 4–12% and 3–8% NuPAGE Tris-Acetate precast polyacrylamide gels (Life Technologies) and analyzed by WB using the antibodies described in Supplementary Information . Immunocomplexes were revealed by using a peroxidase-conjugated secondary antibody (Bio-Rad, Richmond, CA, USA), as appropriate. WB were developed by using the West Dura kit (Pierce Chemical, Rockford, IL, USA). The results were visualised and estimated by Chemi Doc XRS+ with Image lab Software (Bio-Rad). A loading control HSP90 was used.
10
Western Blot Protocol for Protein Quantification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cells were extracted with SDS 1% buffer containing proteases and phosphatases inhibitors (Roche). Protein extracts were loaded in 7.5%, 10% or a 12.5% gel and transferred to a PVDF membrane (Roche). After 1 h of blocking with 5% non-fat milk (Biorad) in Tris Buffered saline- 0.1% Tween 20 (TBS-T), membranes were incubated with the indicated primary antibodies (Table S2 ) overnight at 4 °C. After washes in TBS-T, membranes were incubated during 1 h with the corresponding secondary antibodies. Chemiluminescent detection of protein expression was performed using Pierce ECL Western (BioRad) or Clarity™ Western ECL Substrate (BioRad) depending on the expression level of proteins of interest. Band densities were quantified with Image J Software (https://imagej.nih.gov/ij/ ).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!