3730xl sequence analyzer

We extracted genomic DNA from the dried leaf tissue using a modified cetyl trimethyl ammonium (CTAB) protocol. Quantification of DNA was carried out with a SmartSpecTM Plus Spectrophotometer (Bio-Rad). To select candidate diagnostic microsatellites to identify parental species and hybrids, 219 SSR primers were designed based on sequences previously obtained on a MiSeq Benchtop Sequencer (Illumina, Inc., San Diego, CA, USA) for the close relative P. chungensis [24 (link)]. Detailed protocols for PCR amplification and condition regarding these primers followed Zhou et al. [24 (link)]. PCR products were directly analyzed on a 3730xl Sequence Analyzer (Applied Biosystems, Foster City, CA, USA), using a LIZ GeneScan-500 size standard. Resulting chromatograms were visualized and converted to diploid genotypes using automated allele-calling implemented in GENEMARKER v.4.0 (SoftGenetics LLC, State College, PA, USA). All automated genotyping was re-checked manually. All genotypes for each locus and individual were entered into an Excel file following the format of GenALEx 6.5 [25 (link)].

Primers were designed to amplify the region around the two variants of interest on chr13, chr13:43897196 (F- GCTCCCAAGAAGGGACAGAC; R- TTGGAATAAGATGACAGAGCAAG) and chr13:44170972 (F- AAACGATCCAGAGAGCAGATTAC; R- GAGCCCAGGCCAAGAGTG) using Primer3^{106 (link)}. PCR was carried out on a SimplyAmp thermocycler or GeneAmp PCR system 9700 (Applied Biosystems, Foster City, CA) using AmpliTaq Gold (Thermo Fisher, Waltham, MA) using standard reaction protocols with a touch-down thermocycler program starting at 65 ^oC annealing temperature and decreasing 0.5 ^oC each cycle for 20 cycles then an additional 20 cycles at 55 ^oC annealing temperature. Denaturing and extending temperatures were constant as per standard protocols.
Amplified DNA was sequenced using BigDye Terminator 3.1 (Applied Biosystems, Foster City, CA) and run on a 3730xl sequence analyzer (Applied Biosystems). The variants were genotyped using Sequencher 5.4.6 (GeneCodes Corporation, Ann Arbor, MI). Odds ratios were calculated using genotypes from 47 affected and 47 unaffected Shelties.