Trizol

The phalloidin, JC-1 and DCFH-DA probes were bought from Life Technology (St. Louis, MO, USA). PX-12, DAPI and isoprenaline hydrochloride (Iso) were purchased from Sigma-Aldrich (USA). Rhodamine-conjugated secondary antibodies were obtained from Jackson ImmunoResearch Laboratories (West Grove, PA, USA). STVNa was obtained from Chemical Development Laboratories of Key Biological Pharmaceutical Company (Dongguan, China). Trizol was obtained from Generay (Shanghai, China). Antibodies against Drp1, Trx1, Prdx2 and GAPDH were acquired from Cell Signaling Technology (Beverly, MA, USA). HDAC4 was obtained from Abcam (Cambridge, MA, UK). The Fis1 antibody and HRP-conjugated secondary antibodies were acquired from Santa Cruz Biotechnology (Santa Cruz, CA, USA).

Total RNAs were extracted from cells using TRIzol (Generay, Shanghai, China). Quantified RNA samples were reverse-transcribed into complementary DNA (cDNA) according to HiScript^® II 1st Strand cDNA Synthesis Kit (Vazyme Biotech, Nanjing, China). AceQ qPCR SYBR Green Master Mix (Vazyme Biotech, Nanjing, China) was employed to quantify the target cDNA by using ABI StepOne™ Plus Real-Time PCR System (Applied Biosystems, Foster City, CA, USA) and analyzed using StepOne Software v2.1 (Applied Biosystemss, Foster City, CA, USA). The sequence of the primers for targeting molecules was designed as below: FOXO1, F: TCGTCATAATCTGTCCCTACACA, R: CGGCTTCGGCTCTTAGCAAA; FOXO3a, F: TCACGCACCAATTCTAACGC, R: CACGGCTTGCTTACTGAAGG; FOXO4, F: CCGGAGAAGCGACTGACAC, R: CGGATCGAGTTCTTCCATCCTG. The 2^−ΔΔCT method was used to calculate gene expression levels. All samples were measured in triplicate relative to GAPDH values.

TRIzol purchased from Generay Biotech (Shanghai, China) were utilized to extract total RNA extraction from cells, and the concentration of extracts was measured by ultraviolet spectrophotometry. A PrimeScript® RT reagent Kit (Thermo Fisher, Massachusetts, USA) was used for the reverse transcription of the total RNA. 1 μL of the primers (10 μmol/L) of miR-429 synthesized and purified by Synbio Technology (Suzhou, China) were configured the reaction system according to the instruction of KAPA qRT-PCR kit (Sigma-Aldrich, Missouri, USA). The primer sequences of U6 and miR-429 are shown in Table 1.