To knockdown Brachyury function in Nematostella, we used two non-overlapping antisense morpholinos against brachyury: the translation-blocking morpholino BraATGMO TCGTCCGAGTGCATGTCCGACTATG, and the splice-blocking morpholino BraSpliceMO TCCCTGGTTGTCAACCATACCGTCC. 3-5 pl of both morpholinos were injected at the concentration of 500 µM. 50 µg/ml Dextran-Alexa Fluor 488 MW 10000 (ThermoFisher) was co-injected as tracer to ensure proper delivery of MO (Renfer and Technau, 2017) . Standard morpholino (Genetools) StdMO CCTCTTACCTCAGTTACAATTTATA was injected as a control at the same concentration.
To knockdown Strongylocentrotus brachyury, we injected 2-4 pl of a 200 µM solution of Morpholino previously characterized with the sequence: CGCTCATTGCAGGCATAGTGGCG (Annunziata and Arnone, 2014) . We quanti ed the mortality at 24 hr after fertilization and discarded all experiments with <80% survival. Embryos were either xed for WMISH or used for isolation of RNA extraction at 24 hr. PolyAenriched RNA samples were collected and processed for library production using the Lexogen kit and sequencing (50bp single-end HiSeqV4).
To knockdown Strongylocentrotus brachyury, we injected 2-4 pl of a 200 µM solution of Morpholino previously characterized with the sequence: CGCTCATTGCAGGCATAGTGGCG (Annunziata and Arnone, 2014) . We quanti ed the mortality at 24 hr after fertilization and discarded all experiments with <80% survival. Embryos were either xed for WMISH or used for isolation of RNA extraction at 24 hr. PolyAenriched RNA samples were collected and processed for library production using the Lexogen kit and sequencing (50bp single-end HiSeqV4).