Cdna synthesis kit

Total RNA was extracted using the Trizol Reagent (Invitrogen, United States) and reverse transcribed into complementary DNA using a cDNA Synthesis Kit (GeneCopoeia, United States) according to the manufacturer’s instructions. Quantitative real-time polymerase chain reaction (RT-qPCR) was performed with the mRNA qPCR mix (GeneCopoeia, United States) accordingly. Primers for all assayed genes were determined using reported sequences as listed in Table 1. The annealing temperature was 60°C. The reaction was performed using LightCycler^®480II analyzer (Roche, Mannheim, Germany).

Total RNA from samples specimens or cells was extracted with TRIzol reagent (Invitrogen, Carlsbad, CA, USA). Reverse‐transcribed was performed with cDNA Synthesis Kit (GeneCopoeia Inc., Rockville, MD, USA) following the manufacturer's information. Quantitative real‐time reverse transcription‐PCR (qRT‐PCR) was carried out to determine the expression level of miRNA and LncRNA expression using SYBR‐green PCR kit (GenePharma, Shanghai, China) on PRISM 7900HT system. GAPDH or U6 snRNA was performed to as normalization control and the expression was determined with 2‐DDCT method. qRT‐PCR primers were listed as following: RMRP Forward: 5′‐ACTCCAAAGTCCGCCAAGA‐3′′ and 5′‐GTAACTAGA−GGGAGCTGAC‐3′; GADPH: Forward: 5′‐GTCAA‐CGGATTTGGTCTGTATT‐3′′ and 5′‐AGTCTTCTGGGTGGCAGTGAT‐3′.

Quantitative real-time reverse transcription polymerase chain reaction (RT–PCR) was conducted to verify the changes in mRNA expressions. Extraction of the total RNA from cardiac tissues was performed utilizing the TRIzol (Invitrogen, MO, USA) reagent. Total RNA (1 mg) from each sample was denatured at 65°C for 10 min. Subsequently, the cDNA was synthesized at 37°C for 1 h using a cDNA synthesis kit (GeneCopoeia, Rockville, MD, USA). The 2-△△CT technique was applied to assess relative levels of gene expressions. Below is a list of the primer sequences used in the present study: rat PRR (forward 5′-TCTGTTCTCAACTCGCTCC C-3 and reverse 5′-TCTCCATAACGCTTCCCAAG-3′); RAC1 (forward: 5′- CCTGCTCATCAGTTACACGACCA-3′, reverse: 5′-GTCCCAGAGGCCCAGATTCA-3′), Wnt3A (forward: 5′-ACCATGTTCGGGACCTATTCCA-3′, reverse: 5′-GCCTGTAGCATCTCGCTTCCA-3′); Wnt8A (forward: 5′-GGAGGCCAGGAGAGATG-3, reverse: 5′-ACGGAGACCACAAAAGGA-3′), NOX2 (forward: CTGCCAGTGTGTCGGAATCT
-3′, reverse: 5′-TGTGAATGGCCGTGTGAAGT-3′), NOX4 (forward: 5′- ATGTTGGGCCTAGGATTGTGT -3′, reverse: 5′- TCCTGCTAGGGACCTTCTGT -3′) and GAPDH (forward 5′-AAGTTCAACGGCACAGTCAA-3′ and reverse 5′- TCTCGCTCCTGGAAGATGG -3.)

Following the manufacturer's protocols, Trizol reagent (Thermo Scientific) was used to extract total RNA, and then, a NanoDrop 2000 spectrophotometer (Thermo Scientific) was used to evaluate RNA quality and quantity. Total RNA was reverse transcribed using a cDNA synthesis kit (Genecopoeia), and then, an ABI‐7500 instrument (Applied Biosystems; Thermo Fisher Scientific Inc Waltham) was used to perform real‐time PCR. The expression levels of collagen I and α‐SMA were normalized to GAPDH. The primers used in the reactions are listed below: mouse collagen I 5ʹGCTCCTCTTAGGGGCCACT3ʹ, 3ʹCCACGTCTCACCATTGGGG5ʹ; mouse α‐SMA 5ʹGTCCCAGACATCAGGGAGTAA3ʹ, 3ʹTCGGATACTTCAGCGTCAGGA5ʹ; mouse GAPDH 5ʹAGGTCGGTGTGAACGGATTTGʹ, 3ʹTGTAGACCATGTAGTTGAGGTCAʹ; human collagen I 5ʹCTCCGGCTCCTGCTCCTCTTAG3ʹ, 3ʹGGCAGTTCTTGGTCTCGTCACAG5ʹ, human GAPDH 5ʹGGCACCGTCAAGGCTGAGAACʹ, 3ʹTGCAGGAGGCATTGCTGATGATCʹ; and human α‐SMA 5ʹCAACGTGGAGCGCAGTGGTC3ʹ, 3ʹCAAGGCAGTGCTGTCCTCTTCTTC5ʹ.

Total RNA isolated by TRIzol reagent (Invitrogen, USA) was converted to complementary DNA (cDNA) by a cDNA Synthesis Kit (Gene Copoeia, USA) as per the manufacturer’s instructions. Subsequently, the cDNAs were amplified by real-time qPCR with specific primers (Supplementary Tab. 1) and SYBR-Green dye (Gene Copoeia, USA). PCRs were performed with the following parameters: pre-denaturation at 95 °C for 5 min, 40 cycles of denaturation at 95 °C for 10 s, annealing at 60 °C for 20 s, extension at 72 °C for 30 s. β-Actin was used as an internal control.

Mouse nucleus pulposus tissues (2-3 mg) and nucleus pulposus cells were treated with TNF-α and lysed with TRIzol reagent (Takara Bio, Japan). A total of 1 μg of RNA was used for reverse transcription by a cDNA synthesis kit (GeneCopoeia, Inc., USA). RT-PCR was performed in 10 μl of SYBR Green PCR matrix mix (Toyobo, Japan) on a thermal cycler (Bio-Rad, Hercules, USA). Cycle parameters were as follows: 95°C for 1 min, 40 cycles (95°C for 15 s, 60°C for 15 s, and 72°C for 45 s), and 72°C for 5 min. The RT-PCR results were calculated using the 2^-ΔΔCt method. The primers (FSTL-1, COX-2, MMP-13, ADAMTS-5, β-actin, and iNOS) were designed based on published sequences of these genes and listed in Table 1 [29 , 30 (link)].