Pla2g5−/− (Satake et al., 2004 (link)), Pla2g5tg/+ (Ohtsuki et al., 2006 (link)) and their littermate control mice were backcrossed onto the C57BL/6 mice (Japan SLC) for > 12 generations. Generation of Pla2g2e−/− mice are detailed in Supplemental information . Lepob/ob mice and Fabp4-Cre transgenic mice were obtained from Jackson Laboratory. All mice were housed in climate-controlled (23 °C) pathogen-free facilities with a 12 h light-dark cycle, with free access to standard LFD (CE2; CLEA Japan) and water. Knockout and littermate WT mice (8-wk-old, female) were placed on a HFD (High fat diet 32; CLEA Japan) or LFD for appropriate periods. All procedures were performed in accordance with approvals by the Institutional Animal Care and Use Committees of Tokyo Metropolitan Institute of Medical Science, Showa University, and the University of Washington.
Lepob ob mice
Manufactured by Jackson ImmunoResearch
Sourced in Montenegro
Lepob/ob mice are a strain of laboratory mice that are genetically altered to have a mutation in the leptin (Lep) gene. This mutation results in the development of obesity, diabetes, and other metabolic abnormalities in these mice, which can be used in research to study these conditions.
Automatically generated - may contain errors
Lab products found in correlation
Fabp4 cre transgenic mice, by Jackson ImmunoResearch (1 mentions)
C57bl 6 mice, by Japan SLC (1 mentions)
C57bl 6j, by Jackson ImmunoResearch (1 mentions)
C57bl 6j mice, by Jackson ImmunoResearch (1 mentions)
Ob ob mice, by Jackson ImmunoResearch (1 mentions)
D12451, by Research Diets (1 mentions)
Phosphor screen, by GE Healthcare (1 mentions)
Typhoon 9400 imager, by Cytiva (1 mentions)
Cre inducible tdtomato reporter mouse, by Jackson ImmunoResearch (1 mentions)
7 protocols using lepob ob mice
1
Generating knockout mouse models
2
Obesity in Mice: Diet and Genetic Models
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
We used two mouse models of obesity, the leptin-deficient Lepob/ob mouse, and HFD-induced obesity. For the former, wild-type mice in the C57BL/6J genetic background (Stock no. 000664) and Lepob/ob mice (Stock no. 000632) were purchased from Jackson Laboratories at 6–7 weeks of age and used for experimentation between 8–12 weeks of age. For the latter, male C57BL/6J mice were purchased from Jackson Laboratories and placed on HFD (D12492: 60% kcal% fat; Research Diets) for up to 20 weeks. Control mice of the same age were fed with a low fat diet (PicoLab Mouse Diet 20 #5053, LabDiet). In animal experiments, all measurements were included in the analysis unless they fell more than two standard deviations from the mean.
3
Metabolic Characterization of Cadm2KO Mice
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Mice were housed in groups of 3–5 animals and maintained on a 12-hour light/dark cycle with ad libitum access to regular chow food or high fat diet (containing 60% kcal fat, cat. no. E15741-347, ssniff Spezialdiäten GmbH), in accordance with the Landesamt für Gesundheit und Soziales (LAGeSo). All experimental procedures were approved under protocols G 0216/16, G 0357/10, G 0204/14, O 0405/09, and T 0436/08. Cadm2KO mice were generated by the trans-NIH Knock-Out Mouse Project (KOMP) and obtained from the KOMP Repository (www.komp.org ). Cadm2KO mice were characterized after backcrossing for four generations to C57BL/6 and then crossed to Lepob/ob mice (Jackson Labs). Results were consistent in both genders; however, data from female mice is not shown.
4
Generation and Characterization of Transgenic Mouse Lines
5
Mouse Models of Metabolic Disorders
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All animal work was approved by the Yale University Institutional Animal Care and Use Committee and was conducted accordingly. All mice used in this report were male. Mice were housed at 22–24 oC with a 12 h light/12 h dark cycle with normal chow (NC) (Harlan Teklad no. 2018, 18% calories from fat) or high-fat diets (HFD) (Research Diets, D12451, 45% calories from fat) and water provided ad libitum. The H19 KO and WT mice on a background of C57BL/6J have been previously described17 ,18 (link). To induce insulin resistance (Fig. 2c, d ), WT C57BL/6J mice were exposed to HFD for 11 days or 12 weeks as previously described18 (link). The diet-induced obese and diabetic mice (19–20-week old, fed HFD starting at age of 6 weeks) and Lepob/ob mice (8–9-week old) used in experiments were purchased from the Jackson Laboratories. Before experiments, mice were allowed to acclimate for at least 7 days in our animal facility.
6
EMSA Analysis of Adipose Tissue Nuclear Extracts
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
EMSA was performed by incubating 6 μg of adipose tissue nuclear extracts from 12 to 16 weeks old Lep ob/ob mice (Jackson Lab) in a 20 μl reaction volume with 10 mM HEPES pH 7.9, 4% glycerol, 80 mM KCl, 1 mM MgCl2, 2 μg poly (dI-dC), 3 μg BSA, with 20,000 cpm of the 32P-labeled DNA probe for 20 min at room temperature. Samples were then loaded onto a 4–6% polyacrylamide gel, run at 150V for 4 h, dried, detected overnight in a phosphor screen (GE healthcare) and read in an Amersham Biosciences Typhoon 9400 imager. For supershift assays 2 μg antibody was added after 20 min of incubation with the probe and incubated another 20 min before loaded onto the gel. Antibodies were NFY-A (H209), NFY-B (FL207), C/EBPα (14AA), C/EBPβ (Δ198) from Santa Cruz Biotechnology, Inc. The sequence of the wild type 32 bp probe is TAGTGGGTTAGAGTCTAATTGGAGTAGAGCAG (individual sequences of mutated oligos are shown in Supplementary Table 2 ).
7
Metabolic Regulation in Obese Mice
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All experiments were carried out in accordance with and approved by the Ethics Committee on the Use of Animals of the Institute of Biomedical Sciences at the University of São Paulo (Protocol number: 79/2015). Mice were bred and maintained in standard conditions of light (12 h light: 12 h darkness cycle) and received a regular rodent chow (2.99 kcal/g; 9.4% calories from fat). In the experiments, we used C57BL/6 WT mice, Lep ob/ob mice (Stock No: 000632; The Jackson Laboratory, Bar Harbor, ME) and LepR-reporter mice, which was produced by breeding the LepR-Cre mouse (Stock No: 008320; The Jackson Laboratory) with the Creinducible tdTomato-reporter mouse (Stock No: 007909, The Jackson Laboratory).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!