Trizol kit

Manufactured by Biosharp

Sourced in China

The TRIZOL kit is a reagent used for the isolation and purification of total RNA from various biological samples. It is a monophasic solution of phenol, guanidine isothiocyanate, and other proprietary components that facilitates the effective lysis of cells and the subsequent separation of RNA from DNA and proteins.

Automatically generated - may contain errors

Lab products found in correlation

Reverse transcriptase kit, by Promega (1 mentions)

Close spelling variants of this product

TRIzol (9 citations)

2 protocols using trizol kit

RT-qPCR Analysis of Immune Genes in Oviduct Tissue

Check if the same lab product or an alternative is used in the 5 most similar protocols

The total RNA of the oviduct tissue was extracted using the TRIZOL kit (Biosharp, Hefei, China) and reversely transcribed into cDNA using the cDNA reverse transcription kit (Abconal, Wuhan, China). Real-time quantitative PCR (RT-qPCR) was used with the following program: 95°C for 3 min, 30 cycles of 95°C for 5 s, and 60°C for 30 s, with GADPH as an internal reference. The 2^{− ΔΔCT} method was used to calculate the relative changes in mRNA. Primers were designed by Premier 5 software, with product scores greater than 98. The primer sequences were located in Table 2.Table 2

Primers for real-time quantitative PCR.

Table 2

Gene	Primer sequence (5′–3′)
TLR4	F: TCCCAACCCAACCACAGR: GGATAACAAAGGCATCATAG
NFκB	F: ATGTCTCCATTTGGCATCTATTCAR: TCCTCACTTTCGGGCAGTATCT
TNF-α	F: CCGCCCAGTTCAGATGAGTTR: CAACCAGCTATGCACCCCA
IFN-γ	F: CTGACAAGTCAAAGCCGCACR: TCAAGTCGTTCATCGGGAGC
IL1β	F:GCCTGCAGAAGAAGCCTCGR: GCCTGCAGAAGAAGCCTCG
IL6	F: AAATCCCTCCTCGCCAATCTR: AAATCCCTCCTCGCCAATCT
IL8	F:GCTGCTCTGTCGCAAGGTR: GAATGGATTTAGGGTGGA
IL5	F:GGACATGCTGGTAAGTTCCATR: GGGATGGCCTCAGTTTGTCA

Liu J., Yan P., Li Y., Yu J., Huang Y., Bai R., Liu M., Wang N., Liu L., Zhu J., Xiao J., Guo L., Liu G., Zhang F., Yang X., He B., Zeng J, & Zeng X. (2023). Gut microbiota and serum metabolome reveal the mechanism by which TCM polysaccharides alleviate salpingitis in laying hens challenged by bacteria. Poultry Science, 103(2), 103288.

+ Open protocol

+ Expand

Quantitative Real-Time PCR Analysis of Retinal Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from the harvested retinal tissues using the Trizol kit (Biosharp), and cDNA was reversely transcribed using reverse transcriptase kit (Promega). Later, amplification reaction was followed with 20 μL reaction system composed of 10 μL SYBR-Green qPCR Master Mix, 1 μL cDNA Template, 7.8 μL DEPC water and 0.6 μL each of forward and reverse primers. Primers sequences are shown in Table 1. The thermal reaction cycle of PCR reaction was: one cycle of initial denaturation at 95°C for 2 min; 40 cycles of denaturation at 95°C for 15 s, annealing at 59°C for 20 s, and elongation at 60°C for 40 s. GAPDH was used as an internal reference gene, and the relative expression were calculated using the 2^−ΔΔCt method.

Zhao Z.H., Xu M., Fu C., Huang Y., Wang T.H., Zuo Z.F, & Liu X.Z. (2022). A Mechanistic Exploratory Study on the Therapeutic Efficacy of Astragaloside IV Against Diabetic Retinopathy Revealed by Network Pharmacology. Frontiers in Pharmacology, 13, 903485.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!