RNA was extracted from cells using a commercial kit (RNEasy; Qiagen, Valencia, CA, USA) and 1 μg of RNA reverse transcribed using a reverse transcription kit (Superscript III, 18080093; Thermo Fisher Scientific, Waltham, MA, USA), per the manufacturer's instructions. A total of 3 ng cDNA was subjected to qPCR using SYBR green reagents (ABI 4309155) on a thermocycler (ABI 7900HT; Thermo Fisher Scientific) using exon-spanning gene-specific primers (Supplementary Table S3 ). Each test was run in triplicate with relative transcript levels of target genes expressed as 2−ΔcT with POLR2A as the housekeeping control gene.
Abi 7900ht
Manufactured by Thermo Fisher Scientific
Sourced in United States, China, United Kingdom, Japan, Canada, Germany
The ABI 7900HT is a real-time PCR system designed for high-throughput genetic analysis. It offers precise quantification of nucleic acids and can be used for a variety of applications, including gene expression analysis, SNP genotyping, and pathogen detection.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (58 mentions)
Rneasy mini kit, by Qiagen (33 mentions)
Trizol, by Thermo Fisher Scientific (28 mentions)
High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (27 mentions)
Sybr green pcr master mix, by Thermo Fisher Scientific (13 mentions)
Rneasy kit, by Qiagen (12 mentions)
Sybr green master mix, by Thermo Fisher Scientific (10 mentions)
Sybr green, by Thermo Fisher Scientific (10 mentions)
Superscript 3 first strand synthesis system, by Thermo Fisher Scientific (9 mentions)
Taqman assay, by Thermo Fisher Scientific (7 mentions)
Sds 2, by Thermo Fisher Scientific (7 mentions)
Nucleospin rna kit, by Macherey-Nagel (7 mentions)
Nanodrop nd 1000 spectrophotometer, by Thermo Fisher Scientific (6 mentions)
Primescript rt master mix, by Takara Bio (6 mentions)
Power sybr green pcr master mix, by Thermo Fisher Scientific (6 mentions)
Nanodrop spectrophotometer, by Thermo Fisher Scientific (6 mentions)
Miscript sybr green pcr kit, by Qiagen (6 mentions)
Nanodrop, by Thermo Fisher Scientific (6 mentions)
Fast sybr green master mix, by Thermo Fisher Scientific (5 mentions)
Powerup sybr green master mix, by Thermo Fisher Scientific (5 mentions)
358 protocols using abi 7900ht
1
RNA Extraction and qPCR Analysis
2
MSH3 Methylation and Expression Analysis in Colorectal Cancer
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Bisulphite conversion of tumour and matching control DNA was carried out using the Epitect Bisulfite Kit (Qiagen, Hilden, Germany). MSH3 methylation status was determined by methylation-specific PCR on bisulphite-treated DNA. PCR reactions specific for methylated and unmethylated MSH3 [11 (link)] were performed, with universally methylated and unmethylated DNA (Merck Millipore, Burlington, MA, USA) used as positive and negative controls. Amplified PCR products were run on agarose gels and visualised with the E-Box imager (Vilber Lourmat, Collégien, France). MCC and CDKN2A (p16) methylation and CIMP were analysed as previously described [18 (link),19 (link),31 (link)]. Cancers were classified as either CIMP-H if ≥3/5 of the marker genes showed methylation, CIMP-L when 1–2/5 markers were positive or CIMP-negative when 0/5 markers were positive.
cDNA was prepared from total RNA (or mRNA) using the Quantitect Reverse Transcription Kit (Qiagen, Hilden, Germany), following the manufacturer’s protocol. MSH3 expression was analysed by quantitative RT-PCR using Taqman assays (Thermo Fisher Scientific, Waltham, MA, USA). MSH3 (hs00989003_m1) was normalised to GAPDH (hs99999905_m1). Assays were carried out in triplicate on the ABI7900HT (Thermo Fisher Scientific) and the ΔΔCT method was used for data analysis.
cDNA was prepared from total RNA (or mRNA) using the Quantitect Reverse Transcription Kit (Qiagen, Hilden, Germany), following the manufacturer’s protocol. MSH3 expression was analysed by quantitative RT-PCR using Taqman assays (Thermo Fisher Scientific, Waltham, MA, USA). MSH3 (hs00989003_m1) was normalised to GAPDH (hs99999905_m1). Assays were carried out in triplicate on the ABI7900HT (Thermo Fisher Scientific) and the ΔΔCT method was used for data analysis.
3
Quantitative Real-Time PCR of Stemness Markers
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For the qRT-PCR, BMSCs were seeded into 6-well plate (2 × 105 cells/well). According to the experimental protocol, total RNA was extracted using Trizol reagent (TIANGEN, Beijing, China) and the Nanodrop Lite (ThermoFisher Scientific, USA) was used to measure RNA concentration. The RNA was reverse transcribed into cDNA following the instructions in the ReverTra Ace Qpcr RT Kit (Toyobo Life Science, Shanghai, China). The expression levels of target genes were detected by qRT-PCR on ABI 7900HT (ThermoFisher Scientific) using SYBR Green Realtime PCR Master Mix (Toyobo Life Science). The detailed primer sequences of genes are shown in Table 1 , and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as an internal reference to normalize the expression of each gene.
Sequences of the primers.
| Gene | Forward (5′–3′) | Reverse (5′–3′) |
|---|---|---|
| N cadherin | TCCTGCTTATCCTTGTGCTGA | AAAAGTTGTTTGGCCTGGCG |
| CXCR4 | TGGTCTATGTTGGCGTCTGG | GTCATTGGGGTAGAAGCGGA |
| FN1 | AGCCGAGGTTTTAACTGCGA | CCCACTCGGTAAGTGTTCCC |
| GAPDH | TCATGGGTGTGAACCATGAGAA | GGCATGGACTGTGGTCATGAG |
CXCR4 CXC motif chemokine receptor type 4, FN1 fibronectin 1, GAPDH glyceraldehyde-3-phosphate dehydrogenase
4
Quantitative Real-Time RT-PCR Genotoxicity Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Quantitative real-time reverse transcriptase polymerase chain reaction (real-time RT-PCR) was used to investigate the accordance of gene expression by CTD treatment with a published gene signature for genotoxicity in HepaRG cells (Kreuzer et al., 2020 (link)). Cultivation and treatment were performed as described above. RNA isolation was performed with the RNeasy Mini Kit (Qiagen, Hilden, Germany) and transcription of RNA into cDNA was conducted with the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Foster City, CA, USA), both according to the manufacturers’ protocol. Real-time RT-PCR was performed on ABI7900HT (Thermo Fisher, Waltham, MA, USA) with Maxima SYBR Green/ROX qPCR Master Mix (Thermo Fisher). Thermal cycling started with an initial denaturation at 95 °C for 15 min, followed by 40 cycles of denaturation for 15 s at 95 °C and primer binding and elongation for 60 s at 60 °C. A final elongation step at 60 °C for 15 min and the addition of a dissociation curve step ended the procedure. ACTB, GAPDH and GUSB were used as housekeepers. For analysis of gene expression, their geometric mean was calculated. The 2−ΔΔCT method was used to calculate relative gene expression levels (Livak and Schmittgen, 2001 (link)). Primers were purchased from Eurofins Genomics (Ebersberg, Germany); corresponding sequences are shown in Supplemental Table 1 .
5
Lentiviral CRISPR Screening in A549 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A549-dCas9-KRAB-MeCP2 cells were infected with lentiviruses obtained from individual CROPseq-Guide-Puro plasmids, encoding individual guides. Infected cells were then grown in the presence of 1 μg/mL of puromycin (Sigma). A week later, total RNAs were purified from A549-KRAB-MeCP2 cells infected with guide encoding lentiviruses and RT-qPCR (primers sequences presented in Supplemental Table S2 ) were performed to measure expression of the targeted genes. RT-qPCR was performed using Fast SYBR Green Master Mix (Thermo Fisher Scientific) and ABI 7900HT real-time PCR machine. A validated guide was defined as a guide providing at least 75% inhibition of targeted gene expression compared to a control guide.
6
Quantitative RNA Expression Analysis in Mice
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from N2 pulverized tissues by using miRNeasy kit (Qiagen), treated with DNase (Qiagen), and reverse transcribed with random primers and reverse transcriptase (ThermoFisher), according to the manufacturer’s instructions. Reverse transcriptase PCR (RT-PCR) was performed to validate tissue specific relative expression levels of either PIM1 or PIM2 (both 500 pb band) in TgPIM1/TgPIM2 mice. The cDNA was amplified by PCR using specific primer previously mentioned. To measure mRNA expression by qRT-PCR we used the following TaqMan Gene Expression Assays probes (ThermoFisher) after RT-PCR: PIM1 (Hs01065498_m1), PIM2 (Hs00179139_m1), Pim1 (Mm00435712_m1), Pim2 (Mm00454579_m1), and endogenous housekeepings: GADPH (Hs03929097_g1) and Gadph (Mm99999915_g1). And all immune-related probes: CD4 (Mm00442754_m1), CD8a (Mm01182107_g1), CD74 (Mm00658576_m1), IFNG (Mm01168134_m1), TAP1 (Mm00443188_m1), TAP2 (Mm01277033_m1), and the main HLA in mouse: H2-DMA (Mm00439226_m1), H2-K (Mm01612247_mH), H2-A: (Mm00439211_m1), H2-E: (Mm00772352_m1). Real-time PCR was performed using an ABI 7900HT (ThermoFisher). The relative mRNA quantities were expressed as 2−∆Ct. Relative mRNA quantification and statistical analysis of qPCR data were conducted using RQ Manager 1.2.1 software (ThermoFisher).
7
Gene Expression Analysis in HepaRG Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For gene expression analysis, HepaRG cells were differentiated in 6-well plates and treated with the test compounds for 24 h or 48 h. After treatment, cells were washed twice with ice-cold phosphate-buffered saline (PBS), and RNA was extracted using the RNeasy Mini Kit (Qiagen, Hilden, Germany) following the manufacturer’s protocol. Total RNA was quantified with a spectrophotometer (Nano Drop 1000; Nanodrop Technologies, Wilmington, USA). Synthesis of cDNA was conducted using the High Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Foster City, USA). Real-time qPCR was performed on an ABI 7900HT (Thermo Fisher Scientific, Waltham, USA) using Maxima SYBR Green/ROX qPCR Master Mix (Fermentas, St. Leon Rot, Germany). PCR products were verified by melting curve analysis. Relative changes in mRNA transcription levels were quantified using the 2−ΔΔCt method (Pfaffl 2001 (link)) normalized to GAPDH. Primer sequences are listed in Table S1. Three individual experiments were performed.
8
qRT-PCR Evaluation of Genotoxicity Gene Signature
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
qRT-PCR was used to investigate the transferability of a published gene signature for genotoxicity from HepaRG cells to TK6 cells (of the 37 published genes, 33 genes were chosen for further analysis), as well as to verify the TK6 RNA sequencing data. Cultivation, treatment and RNA isolation were performed as described above. The transcription of RNA into cDNA was conducted with the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Foster City, CA, USA) according to the manufacturer’s protocol.
qRT-PCR was carried out with the Maxima SYBR Green/ROX qPCR Master Mix (Thermo Fisher Scientific, Waltham, MA, USA) on a ABI7900HT (Thermo Fisher Scientific). The thermal cycling procedure started with an initial denaturation at 95 °C for 15 min. This was followed by 40 cycles of denaturation for 15 s at 95 °C and primer binding and elongation for 1 min at 60 °C. The procedure ended with a final elongation at 60 °C for 15 min and the addition of a dissociation curve step. Primers were purchased from Eurofins Genomics (Ebersberg, Germany); the sequences are shown inSupplementary Table S8 . ACTB, GAPDH, and GUSB were used as housekeepers and geometrically averaged.
qRT-PCR was carried out with the Maxima SYBR Green/ROX qPCR Master Mix (Thermo Fisher Scientific, Waltham, MA, USA) on a ABI7900HT (Thermo Fisher Scientific). The thermal cycling procedure started with an initial denaturation at 95 °C for 15 min. This was followed by 40 cycles of denaturation for 15 s at 95 °C and primer binding and elongation for 1 min at 60 °C. The procedure ended with a final elongation at 60 °C for 15 min and the addition of a dissociation curve step. Primers were purchased from Eurofins Genomics (Ebersberg, Germany); the sequences are shown in
9
Endometrial mRNA Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from endometrial tissues was extracted using TRIzol regent (Invitrogen, Carlsbad, CA, USA) and then reverse-transcribed into cDNA using the PrimeScript RT Reagent Kit (Servicebio, Co., Ltd., Wuhan, China). RT-qPCR was performed to detect target mRNA expression (ABI 7900HT, Thermo Fisher Scientific, Waltham, MA, USA), which was normalized to ACTB expression. The RT-qPCR primer sequences are listed in Supplementary Table S3 . The 2−ΔΔCt method was used to analyze the results.
10
Quantitative RT-PCR Analysis of HIF-1α/2α, VEGF-α, and HO-1
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The tissue samples were homogenized, and total RNA was isolated using the RNeasy Mini Kit (no. 74104; Qiagen). Predesigned assays for primers of the 18s housekeeping gene (Rn03928990_g1) and HIF-1α (Rn01472831_m1), HIF-2α (Rn00576515_m1), VEGF-α (Rn01511602_m1), and HO-1 (Rn00561387_m1) genes were obtained from Thermo Fisher Scientific. Real-time PCR was performed on ABI 7900 HT (Thermo Fisher Scientific). Data were calculated by the 2−ΔΔCt method (where Ct is threshold cycle).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!