Gene pulser xcell system

Manufactured by Bio-Rad

Sourced in United States

The Gene Pulser Xcell System is a laboratory instrument designed for electroporation, a technique used to introduce foreign genetic material into cells. The system provides a controlled electrical pulse to facilitate the uptake of DNA, RNA, or other molecules into cells. The core function of the Gene Pulser Xcell System is to enable efficient and reliable electroporation for various applications in molecular biology and cell biology research.

Automatically generated - may contain errors

Lab products found in correlation

Close spelling variants of this product

Gene Pulser (533 citations) Gene Pulser Xcell (489 citations) Gene Pulser Xcell Electroporation System (272 citations) Gene Pulser system (48 citations) Gene Pulser Xcell Total System (21 citations) Pulser XCell (8 citations) Gene Pulser Xcell Microbial System (7 citations) Gene Pulser Xcell Eukaryotic System (5 citations) Gene Pulser Xcell System apparatus (2 citations)

112 protocols using gene pulser xcell system

Genetic Manipulation of Mouse and Human Cells

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

In mouse ESCs, for Pwp1 knockdown, an shRNA targeting Pwp1 mRNA was designed (shPwp1-tet-A, Table S1) and cloned into the lentivirus vector pLKO-Tet-On (a gift from Zhang Xiaoqing Lab, Tongji University, China). For Pwp1 knockout, a gRNA targeting the major open reading frame of Pwp1 was designed (Pwp1 gRNA, Table S1) and cloned as previously described^{59 (link)}. For HA-POT1b knock in, a gRNA was designed (HA-Pot1b gRNA, Table S1) through the website Optimized CRISPR Design (http://crispr.mit.edu/). For protein overexpression, cDNAs were cloned into the vector FUGW (Addgene), and plasmids were electroporated into E14.1 mESCs using Gene Pulser X Cell System (Bio-Rad).
To knockdown PWP1 in human cells, an shRNA targeting PWP1 mRNA was designed (shPWP1-A, Table S1) and cloned into the lentivirus vector pLKO.1 (Addgene). Human shelterin plasmids (gifts from Dr. Mao Zhiyong Lab, Tongji University, China) were electroporated into cells using Gene Pulser X Cell System (Bio-Rad).

Yu Y., Jia W., Lyu Y., Su D., Bai M., Shen J., Qiao J., Han T., Liu W., Chen J., Chen W., Ye D., Guo X., Zhu S., Xi J., Zhu R., Wan X., Gao S., Zhu J, & Kang J. (2019). Pwp1 regulates telomere length by stabilizing shelterin complex and maintaining histone H4K20 trimethylation. Cell Discovery, 5, 47.

+ Open protocol

+ Expand

Transient Gene Silencing in HCAEC

Check if the same lab product or an alternative is used in the 5 most similar protocols

For gene silencing studies, the Gene Pulser XcellTM system (Bio-Rad, Hercules, CA, USA) was used for transient transfection of HCAEC with gene-specific siRNA (60–70% transfection efficiency achieved). Briefly, 2 × 10⁵ cells were transfected with 2 μg of siRNA targeting Flk-1 (Ambion, Austin, TX, USA) or a scrambled negative control siRNA (Ambion, cat #4611) in 75μL of siRNA electroporation buffer. Following transfection, cells were treated with or without ethanol for 24 h and/or Notch ligand Delta like ligand 4 (DII4, 2.0 μg).

Morrow D., Hatch E., Hamm K., Cahill P.A, & Redmond E.M. (2014). Flk-1/KDR Mediates Ethanol-Stimulated Endothelial Cell Notch signaling and Angiogenic Activity. Journal of vascular research, 51(4), 315-324.

+ Open protocol

+ Expand

Plasmid Transfection and Luciferase Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols

Plasmids were prepared for transfection using a Qiagen plasmid midi kit. Cells were plated onto 6-well plates 2 days prior to transfection, at a density of 1×105 cells/well, and were transfected at 70% confluency. Plasmid transfection was performed using the Gene Pulser XcellTM system (Bio-Rad, Hercules, CA, USA). The cells were transfected with the indicated expression constructs, with the addition of a total of 5.0μg DNA/well. Transfection efficiency was confirmed and normalized to β-galactosidase (β-gal) activity following co-transfection with CMV-LacZ, a plasmid-encoding β-gal activity. Western blot analysis was performed to confirm overexpression of effector proteins. In luciferase reporter studies, cells were harvested 16–24 h post transfection, using 1 X Reporter Lysis Buffer (Promega, Madison WI). Transactivation of reporter genes was evaluated by the luciferase assay (Promega) and normalized to the β-gal activity. The latter was performed according to the manufacturer’s instructions (High Sensitivity β-galactosidase Assay; Stratagene, La Jolla, CA).

Hatch E., Morrow D., Liu W., Cahill P.A, & Redmond E.M. (2015). Ethanol inhibits γ-secretase proteolytic activity in vascular smooth muscle cells. Alcoholism, clinical and experimental research, 39(11), 2115-2122.

+ Open protocol

+ Expand

Luciferase Assay for Transcriptional Regulation

Check if the same lab product or an alternative is used in the 5 most similar protocols

Luciferase assay was performed as previously described [16 (link)]. Briefly, 293T cells were co-transfected with the firefly luciferase reporter vectors along with IRF8 (WT or K108E mutant), IRF1, and renilla expression plasmids using Lipofectamine 2000 reagent (Cat# 11668019, Life Technologies). The Akata (EBV⁺) cell was transfected using electroporation method. For plasmid transfection, 10 μg each of plasmid were mixed with 5x10⁶ cells in a 4-mm cuvette. Electroporation was performed at 970 μF and 0.2 V with a Gene pulser Xcell system (Bio-Rad). The cells were transferred to new plates contain 10 ml pre-warmed fresh medium. At thirty-six hours post-transfection, cell extracts were prepared and assayed with the dual-luciferase assay kit from Promega (Cat #E1960, Madison, WI, USA). Each condition was performed in triplicate.

Lv D.W., Zhang K, & Li R. (2018). Interferon regulatory factor 8 regulates caspase-1 expression to facilitate Epstein-Barr virus reactivation in response to B cell receptor stimulation and chemical induction. PLoS Pathogens, 14(1), e1006868.

+ Open protocol

+ Expand

Generation and Characterization of Mouse BM-DCs

Check if the same lab product or an alternative is used in the 5 most similar protocols

Bone marrow from mouse tibias and femurs were counted and grown at 2×10⁵ cells/ml in petri dishes with 10mL complete RPMI media containing 20ng/mL GM-CSF (Peprotech; Cranbury, NJ). On day 3, an additional 10mL media with 20ng/mL GM-CSF was added. On day 6, half the media was replenished with 10mL complete RPMI media containing 20ng/mL GM-CSF. At day 7 or 8, cells were used or matured further using 30ng/mL TNF-α for another 48hours. Confirmation of BMDC cell surface phenotype was assessed by FACs analysis.
siRNA knockdown of mLMAN1 was performed via electroporation using a Gene Pulser Xcell system (Biorad; Hercules, CA). The conditions were: 400V, 150μF, 100Ω using 2 × 10⁶ cells/cuvette in a 200 μL volume containing 6 μg of control or mLMAN1-specific siRNA (Qiagen; Germantown, MD).

Miller M.H., Swaby L.G., Vailoces V.S., LaFratta M., Zhang Y., Zhu X., Hitchcock D.J., Jewett T.J., Zhang B, & Tigno-Aranjuez J.T. (2023). LMAN1 is a receptor for house dust mite allergens. Cell reports, 42(3), 112208.

+ Open protocol

+ Expand

Cloning and Transfection of Chinese Hamster St6gal1

Check if the same lab product or an alternative is used in the 5 most similar protocols

The coding sequence of Chinese hamster St6gal1 was obtained from GenBank (AB492855) and chogenome.org (AFTD01061789 and AFTD01061790). The open reading frame was synthesized by DNA2.0 (Menlo Park, CA) with a Kozak sequence (5′-GCCGCCACCAatg-3′) added to the 5′-untranslated region (UTR). The synthesized fragment was cloned into expression vector pJ602 (DNA2.0). Both IgG expressing and the CHOZN^® GS host cell line were transfected by this construct. Cells were seeded at 10⁶ cells/mL in 50 mL TPP TubeSpin^® Bioreactors (Trasadingen, Switzerland) one day prior to transfection. 5 × 10⁶ cells in 800 μL growth media and 30 μg plasmid DNA were used for each transfection. Transfections were conducted by electroporation at 300 V and 950 μF in 0.4-cm cuvettes using a Gene Pulser XCell™ system (Bio-Rad, Hercules, CA). Electroporated cells were subsequently placed in 6 mL growth media in a suspension 25-cm² tissue culture flask (Greiner Bio-One, Monroe, NC) for 24 h prior to 250 μg/mL Zeocin^® (Life Technologies, Carlsbad, CA) selection. Once the stably transfected pool was > 95% viable, cells were collected for quantitative reverse transcription polymerase chain reaction (qRT-PCR) for overexpression validation.

Lin N., Mascarenhas J., Sealover N.R., George H.J., Brooks J., Kayser K.J., Gau B., Yasa I., Azadi P, & Archer-Hartmann S. (2015). Chinese Hamster Ovary (CHO) Host Cell Engineering to Increase Sialylation of Recombinant Therapeutic Proteins by Modulating Sialyltransferase Expression. Biotechnology progress, 31(2), 334-346.

+ Open protocol

+ Expand

Silencing WASP, N-WASP, and AT2R in Jurkat and HeLa Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

siRNAs were ON-Target plus SMARTpools (GE Healthcare) targeting human WASP (L-028294-00-0005), N-WASP (L-006444-00-0005), or AT2R (L-005429-00-005) or were nontargeting SMARTpool (D0018101005) as controls. 10⁷ Jurkat T cells were electroporated twice at 48-h interval with 400 nM siRNA using the Gene Pulser Xcell system (Bio-Rad Laboratories) at 300 V and 500 µF. Silencing of WASP/N-WASP expression was optimal 24 h after the second electroporation. HeLa cells were transfected with 10 nM siRNA using Lipofectamine RNAiMAX (Invitrogen). AT2R silencing was optimal 48 h after transfection.

Baron L., Paatero A.O., Morel J.D., Impens F., Guenin-Macé L., Saint-Auret S., Blanchard N., Dillmann R., Niang F., Pellegrini S., Taunton J., Paavilainen V.O, & Demangel C. (2016). Mycolactone subverts immunity by selectively blocking the Sec61 translocon. The Journal of Experimental Medicine, 213(13), 2885-2896.

+ Open protocol

+ Expand

Electroporation Protocol for Cell Transfection

Check if the same lab product or an alternative is used in the 5 most similar protocols

Electroporation was performed using the Gene Pulser Xcell System (Bio-Rad) at 250 V, 500µF in a 0.4 cm cuvettes (Phenix Research Products). Details are given in Supplemental Experimental Procedures.

Chen Y., Cao J., Xiong M., Petersen A.J., Dong Y., Tao Y., Huang C.T., Du Z, & Zhang S.C. (2015). Engineering Human Stem Cell Lines with Inducible Gene Knockout using CRISPR/Cas9. Cell stem cell, 17(2), 233-244.

+ Open protocol

+ Expand

CRISPR-mediated Editing of TRIM72 Promoter

Check if the same lab product or an alternative is used in the 5 most similar protocols

gRNAs were designed using online software from Feng Zhang’s lab (http://crispr.mit.edu/). gRNA1: CTGATGCC GAGTGATCAATG; gRNA2: ATGGGACTCTGACGGCCAAG.
The human TRIM72 promoter region was amplified by PCR using primer pairs (5K-u2: GAGCACCAGCTTCCTGA GACTTT and 5k-d3: ATACCAACGAAAGGACGGTGGTC). PCR products were subcloned into T-vectors and served as donor templates for CRISPR/Cas9 mediated homologous recombination, containing the 5′arm (chr16: 31222399–31223506, hg19) and 3′arm (chr16: 31225890–31227513, hg19) of the human genomic sequence.
Human H1 embryonic stem cells were cultured to 80–90% confluence in mTeSR1 medium (85850, STEMCELL Technologies). Cells were then digested into single cells using Accutase (07920, STEMCELL Technologies) and resuspended in mTeSR1 + 5 µM Y27632. Cells (1 × 10⁷) were electroporated with a combination of Cas9 plasmids (8 μg) (#44719, Addgene), two gRNAs (5 μg each), and recombinant donor plasmid (8 μg) in 800 μl ice cold DPBS (Invitrogen) using the Gene Pulser Xcell System (Bio-Rad) at 250 V and 500 μF in 4-mm cuvettes (Bio-Rad). H1 clones were then picked and screened by PCR using the following primers: Primer4: CAGTTTCATTCTCTTGCATAAGG and Primer6: CTTAAGCTCCTCAGACCCTCTTTC. PCR products were Sanger sequenced to confirm the genomic sequence of the edited clones.

Feng Y., Xu H., Liu J., Xie N., Gao L., He Y., Yao Y., Lv F., Zhang Y., Lu J., Zhang W., Li C.Y., Hu X., Yang Z, & Xiao R.P. (2021). Functional and Adaptive Significance of Promoter Mutations That Affect Divergent Myocardial Expressions of TRIM72 in Primates. Molecular Biology and Evolution, 38(7), 2930-2945.

+ Open protocol

+ Expand

CRISPR Genome Editing in hPSCs

Check if the same lab product or an alternative is used in the 5 most similar protocols

hPSCs were cultured in hESCM with 1 mM Y-27632 (Calbiochem, Y27632), a Rho kinase inhibitor, for 3 hr prior to electroporation. Cells were then digested by trypsin for 3 min into single cells and rinsed with PBS twice. Cells (1 × 10⁷) were electroporated with appropriate combination of Cas9 plasmids (5 μg) (Addgene #44719), two gRNAs (5 μg), and CAG promoter-driven puromycin plasmid (5 μg) (Cui et al., 2016 (link)) in 200 μL of electroporation buffer using the Gene Pulser Xcell System (Bio-Rad) at 250 V and 500 μF in 0.4-cm cuvettes (Phenix Research Products). Cells were treated with puromycin (0.5 μg/mL) from day 2 to day 5 post electroporation. After puromycin selection MEF-conditioned hESCM was supplied, and drug-resistant colonies could be picked up for genotyping analyses after 10 days post electroporation. Primer sets for genomic DNA PCR are provided in Supplemental Experimental Procedures.

Liu Z., Hui Y., Shi L., Chen Z., Xu X., Chi L., Fan B., Fang Y., Liu Y., Ma L., Wang Y., Xiao L., Zhang Q., Jin G., Liu L, & Zhang X. (2016). Efficient CRISPR/Cas9-Mediated Versatile, Predictable, and Donor-Free Gene Knockout in Human Pluripotent Stem Cells. Stem Cell Reports, 7(3), 496-507.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!