Kod plus neo buffer

P. falciparum or P. vivax DNA was extracted from filter papers or whole blood collected from the patients using QIAamp DNA Blood Mini kit (QIAGEN, Hilden, Germany) according to the manufacturer’s instructions. The regions encoding PfMSP1₁₉ and PvMSP1₁₉ were amplified with the following primer pairs: PfMSP1₁₉ forward (TCACAACACCAATGCGTAAAA) and reverse (GAGTATTAATAAGAATGATATTCCTAAG); and PvMSP1₁₉ forward (ACCAATGTGGCTGATAATGC) and reverse (TCAAAGAGTGGCTCAGAACC). Each 20 μl of PCR mixture contained 11.7 μl sterile water, 2 μl of 10×KOD-Plus-Neo buffer, 0.8 μl MgSO₄ (25 mM), 2 μl dNTP mixture (2 mM), 1.0 μl of each primers (10 μM), 0.5 μl KOD PLUS-Neo DNA polymerase (1Unit/μl) (Toyobo, Japan) and 1 μl template DNA. Cycling conditions were as follows: 94°C for 2 min, 40 cycles of 94°C for 15 sec, 56°C for 15 sec, and 68°C for 1 min, and then a final extension at 68°C for 5 min. The PCR products were purified using the QIAquick Gel Extraction Kit (QIAGEN, CA, USA) and sequenced with the PCR primers in both directions (BGI Tech Solutions Co., Ltd.). MSP1 fragments from 45 P. falciparum and 76 P. vivax monoclonal infections were successfully sequenced. To evaluate the polymorphism of PMSP1₁₉ gene, the MSP1 gene of P. falciparum 3D7 strain or P. vivax Sal-I strain was used as the references. The sequences were aligned using the CLUSTALW program in MEGA 6.0.